Información

En los insectos, ¿la repetición de la alanina ocurre en la secuencia del homeodominio del abdomen o ocurre en una secuencia diferente?

En los insectos, ¿la repetición de la alanina ocurre en la secuencia del homeodominio del abdomen o ocurre en una secuencia diferente?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Por "repetición de alanina", me refiero a la supresión de la formación de patas de insecto adicionales debido a la supresión del gen Ubx a través de la represión sin distal.


Algunos antecedentes:

El nuevo trabajo implicó la misexpresión de la proteína Drosophila Ubx en el presunto tórax de embriones transgénicos de mosca de la fruta. El desarrollo de las extremidades fue suprimido debido a la represión de Dll. Por el contrario, la expresión mixta de las proteínas Ubx de onicóforos y crustáceos no interfirió con la expresión de Dll y la formación de las extremidades torácicas. Estos resultados plantearon la posibilidad de que la proteína Ubx de Drosophila sea funcionalmente distinta de Ubx en onicóforos y crustáceos. Un estudio sugiere que Drosophila Ubx ha adquirido un péptido rico en alanina que media la represión de la transcripción genética; este péptido carece de onicóforos. El otro estudio proporciona evidencia de que el crustáceo Ubx contiene un péptido adicional que modula la actividad del péptido rico en alanina, y posiblemente otros dominios de represión, en el crustáceo Ubx.

Las secuencias restringidas por insectos incluyen cuatro regiones N-terminal al homeodominio (I1-I4), un motivo peptídico (QAQAQK) y una serie extendida de residuos de alanina C-terminal al homeodominio

La proteína Ubx del onicóforo podría funcionar como un activador del desarrollo de apéndices. Cuando los onicóforos y los artrópodos divergieron, Ubx adquirió un dominio de represión rico en alanina cerca de su terminal carboxi. Este dominio media la represión constitutiva en insectos. Pero en los crustáceos, la adición del péptido regulador hace que funcione de forma condicional. Como resultado, Ubx no suprime el desarrollo de las extremidades en los crustáceos. Pero elimina las extremidades abdominales en los insectos, reduciendo en gran medida el número total de apéndices en comparación con los crustáceos.

Usted puede leer sobre ello aquí:

Levine, Mike. "Biología evolutiva: cómo los insectos pierden sus extremidades". Nature 415.6874 (2002): 848-849.

Galant, Ron y Sean B. Carroll. "Evolución de un dominio de represión transcripcional en una proteína Hox de insecto". Nature 415.6874 (2002): 910-913.


El aminoácido en tándem se repite en el anole verde (Anolis carolinensis) y otros escamatos pueden tener un papel en el aumento de la variabilidad genética.

Las repeticiones de aminoácidos en tándem se caracterizan por la recurrencia consecutiva de un solo aminoácido. Exhiben altas tasas de mutaciones de longitud además de mutaciones puntuales y se ha propuesto que están involucradas en la plasticidad genética. Los reptiles cuadrangulares (lagartos y serpientes) se diversifican tanto en morfología como en fisiología. El mecanismo subyacente aún no se ha entendido. En un análisis filogenómico previo de reptiles, la densidad de repeticiones en tándem en un lagarto anole divergía en gran medida de la de los otros reptiles. Para obtener más información sobre las repeticiones de aminoácidos en tándem en escamatos, analizamos el contenido de repetición en el anole verde (Anolis carolinensis) proteoma y comparó las repeticiones de aminoácidos en un gran conjunto de datos de proteínas ortólogas de seis vertebrados (la rana de garras occidentales, el anole verde, la tortuga de caparazón blando chino, el pinzón cebra, el ratón y el ser humano).

Resultados

Nuestros resultados revelaron que el número de repeticiones de aminoácidos en el anole verde excedía a las encontradas en las otras cinco especies estudiadas. Se encontraron repeticiones de solo especies en alta proporción en el anole verde, pero no en las otras cinco especies, lo que sugiere que el anole verde había ganado muchas repeticiones de aminoácidos en cualquiera de los dos. Anolis o el linaje escamoso. Dado que los genes que contienen repeticiones de aminoácidos en el anole verde estaban altamente enriquecidos en genes relacionados con la transcripción y el desarrollo, se estudió más a fondo una familia importante de genes del desarrollo, es decir, la familia Hox, en una amplia colección de escamatos. También se observaron abundantes repeticiones de aminoácidos, lo que implica la alta tolerancia general de las repeticiones de aminoácidos en los escamatos. Se observó un enriquecimiento particular de repeticiones de aminoácidos en los genes Hox de clase central que se sabe que son responsables de definir las regiones cervical a lumbar.

Conclusiones

Nuestro estudio sugiere que las abundantes repeticiones de aminoácidos en el anole verde, y posiblemente en otros escamatos, pueden desempeñar un papel en el aumento de la variabilidad genética y contribuir a la diversidad evolutiva de este clado.


Reconocimiento del no-yo

Las reacciones inmunes se inician cuando las moléculas de origen microbiano se detectan y reconocen como "no propias". Este paso de reconocimiento involucra receptores de reconocimiento de patrones (PRR) que reconocen y se unen a los llamados patrones moleculares asociados a patógenos (PAMP) que son compartidos por varios microorganismos pero ausentes en las células eucariotas (Medzhitov y Janeway, 1997b, 2002). Los PAMP que se sabe que son potentes inductores inmunitarios incluyen lipopolisacáridos (LPS), peptidoglicano (PGN) y β-1,3-glucanos. Se han identificado y aislado varios PRR de vertebrados (Holmskov et al., 2003 Takeda et al., 2003) e invertebrados (Gobert et al., 2003 Hoffmann, 2003 Wilson et al., 1999 Yu et al., 2002). Los PRR de invertebrados mejor estudiados son las proteínas de reconocimiento de peptidoglicanos (PGRP) y las proteínas de unión a bacterias gramnegativas (GNBP). Los PGRP son proteínas solubles o transmembrana que contienen un dominio similar al dominio amidasa bacteriana, que participa en el reciclaje de fragmentos de la pared celular bacteriana. Se han aislado PGRP tanto de invertebrados como de vertebrados (Dziarski et al., 2003 Wang et al., 2003). El primero fue aislado de la hemolinfa de la polilla. Bombyx mori, donde participa en la activación de la cascada de la profenoloxidasa (PPO) (Yoshida et al., 1996). En Drosophila, se identificaron tres PGRP como De buena fe PRR. El PGRP-SA soluble activa la vía Toll en respuesta a una infección bacteriana Gram-positiva (Gobert et al., 2003 Michel et al., 2001) junto con otro PRR, GNBP1. Por el contrario, PGRP-LC (Choe et al., 2002 Gottar et al., 2002 Ramet et al., 2002) y PGRP-LE (Takehana et al., 2002) están involucrados en la activación de la vía de inmunodeficiencia (IMD) en respuesta a infecciones bacterianas Gram-negativas. Entre los siete putativos identificados Anofeles PGRP (Christophides et al., 2002), PGRPLC parece jugar un papel central en la defensa contra la infección bacteriana (G. K. Christophides, datos no publicados). Los genes ortólogos en ambos Drosophila (Werner et al., 2003) y Anofeles(Christophides et al., 2002) se someten a un empalme alternativo que da como resultado al menos tres isoformas distintas. Curiosamente, el Anopheles PGRPLC las isoformas se regulan diferencialmente tras la provocación inmunitaria, lo que sugiere que el corte y empalme puede ser regulado por la señal inmunitaria (Christophides et al., 2002). Por otra parte, PGRPLB está transcripcionalmente regulado al alza siguiendo Plasmodium infección de mosquitos adultos (Dimopoulos et al., 2002) y mantiene una expresión elevada durante todo el ciclo de vida del parásito (Christophides et al., 2002).

Los GNBP se describieron por primera vez en Bombyx mori(Lee et al., 1996) y comparten una similitud de secuencia significativa con la región catalítica de las β-1,3- y β-1,3,1,4-glucanasas bacterianas. BmEl GNBP se une fuertemente a la superficie de las bacterias Gram-negativas y muestra una regulación positiva de la transcripción pronunciada después del desafío bacteriano (Lee et al., 1996). los Drosophila GNBP1 se une con alta afinidad a LPS y β-1,3-glucano (Kim et al., 2000) y, junto con PGRP-SA, activa la vía Toll tras la infección con bacterias Gram-positivas (Gobert et al., 2003) . En A. gambiae, seis putativos GNBP se han identificado (Christophides et al., 2002). Entre ellos, GNBPB1 y GNBPA1 están regulados al alza siguiendo Plasmodium infección, mientras que solo GNBPB1 responde a las bacterias (Christophides et al., 2002 Dimopoulos et al., 2002). Otro putativo Anofeles Los PRR incluyen las proteínas que contienen tioéster (TEP), las proteínas inmunes ricas en leucina (LRIM) y las lectinas de tipo C (CTL). Los miembros de estas familias de proteínas estuvieron implicados recientemente en la regulación de Plasmodium desarrollo en el vector del mosquito y se discuten más adelante en esta revisión.


Resultados

Conservación de estructuras génicas ortólogas de TpnI y TpnT en insectos

Hemos utilizado el informe previamente D. melanogaster Secuencias de genes TpnT y TpnI (Barbas et al. 1993 Benoist et al. 1998) para encontrar supuestos ortólogos en el Anofeles y Apis genomas. La organización estructural de estos genes se ha conservado en un alto grado en insectos (fig. 1). En general, observamos un aumento en el tamaño del gen, principalmente debido a la expansión de la longitud del intrón del genoma más pequeño, 178 Mb en D. melanogaster (Adams et al. 2000) - a los de Anofeles y Apis que son casi el doble de tamaño (Holt et al. 2002). La ubicación cromosómica no es una característica ampliamente conservada en insectos, ni para los genes TpnC (Herranz, Mateos y Marco 2005) ni para los de TpnI o TpnT. Los genes TpnT y TpnI están ubicados en el D. melanogaster Cromosoma X, pero el Anofeles El gen TpnT se localiza citológicamente en el brazo del cromosoma 2R, mientras que TpnI queda por localizar (Mongin et al. 2004).

Estructuras de genes de troponina T (arriba) y troponina I (abajo) en insectos holometábolos. Los genes están etiquetados con la abreviatura de dos letras del binomio de especies. Se indican los exones alternativos no codificantes (blanco), constitutivos (gris), alternativos (negros) o mutuamente excluyentes (rayas diagonales) y que contienen PAANGKA o APPAEGA (rayas horizontales). El exón 6 sombreado claro en TpnI aún no se ha detectado en experimentos de RT-PCR. Números de exón en Anofeles y Apis genes han sido asignados por homologa a los de su Drosophila contrapartes. El ADN genómico está representado por una línea continua que, por lo tanto, falta en las secuencias de genes derivadas de los datos de ADNc. La organización de los genes está bien conservada en general y el tamaño de los genes se correlaciona con el tamaño del genoma del organismo. La principal diferencia afecta a las secuencias ricas en alanina / prolina, incluido el exón 3 de TpnI que codifica las secuencias de PAANGKA en Drosophilidae, pero no en Anofeles o Apis. Varios Apis Los exones del gen TpnI codifican una secuencia que contiene APPAEGA en su región 3 '.

Estructuras de genes de troponina T (arriba) y troponina I (abajo) en insectos holometábolos. Los genes están etiquetados con la abreviatura de dos letras del binomio de especies. Se indican los exones alternativos no codificantes (blanco), constitutivos (gris), alternativos (negros) o mutuamente excluyentes (rayas diagonales) y que contienen PAANGKA o APPAEGA (rayas horizontales). El exón 6 sombreado claro en TpnI aún no se ha detectado en experimentos de RT-PCR. Números de exón en Anofeles y Apis genes han sido asignados por homologa a los de su Drosophila contrapartes. El ADN genómico está representado por una línea continua que, por lo tanto, falta en las secuencias de genes derivadas de los datos de ADNc. La organización de los genes está bien conservada en general y el tamaño de los genes se correlaciona con el tamaño del genoma del organismo. La principal diferencia afecta a las secuencias ricas en alanina / prolina, incluido el exón 3 de TpnI que codifica las secuencias de PAANGKA en Drosophilidae, pero no en Anofeles o Apis. Varios Apis Los exones del gen TpnI codifican una secuencia que contiene APPAEGA en su región 3 '.

Hemos clonado y secuenciado las transcripciones de estos genes en las especies de drosófilos y Apis, prestando especial atención a los exones empalmados alternativamente. En el caso de la troponina T, los exones N t empalmados diferencialmente están presentes en todas las especies analizadas, aunque en Apis el gen TpnT muestra un exón empalmado alternativamente adicional, denominado 5 '. los Apis equivalente al exón 6 dípteros se divide en cinco exones constitutivos (a, b, c, dye). La secuenciación de transcripciones identificó una nueva variable exón 10, que se había pasado por alto en estudios previos de D. melanogaster y D. virilis transcripciones secuenciadas de TpnT (Benoist et al. 1998). La comparación de las secuencias genómicas de TpnT en insectos mostró que dos exones diferentes, denominados 10A y 10B, están presentes en todas las especies de holometábolos. Ambos tienen 79 nt de longitud y codifican 26 aa. Otra diferencia en la estructura del gen TpnT se encuentra en el exón 11, que codifica una cola poliglutámica larga con tamaño variable en todas las especies de protostomas estudiadas (Benoist et al. 1998).

Los exones constitutivos y el exón 9 del gen TpnI están presentes en todos los insectos analizados (fig.1), pero el exón 3 no lo está, en la medida en que el Drosophila Los exones ortólogos 2 y 4 se fusionan en un exón único en Anofeles, pero no en Apis donde se encuentra un exón 3 más pequeño, la principal variabilidad de la troponina I surge de los exones 6 mutuamente excluyentes. En el caso de Anofeles, detectamos tres variantes del exón 6 por homología de secuencia, mientras que cuatro se detectaron en Apis. Curiosamente, los exones adicionales, que hemos designado H1, H2 y H3, se encontraron aguas abajo del exón 10 en el Apis Gen TpnI, que codifica las secuencias repetitivas APPAEGA (ver más abajo).

Variaciones de secuencia de los exones empalmados alternativamente en los genes TpnT y TpnI

Las secuencias de aminoácidos de los exones constitutivos de TpnT y TpnI se conservan casi perfectamente en insectos. Como se muestra en la figura 2A, incluso las secuencias de los exones empalmados alternativamente (3, 4 y 5) de TpnT están bien conservadas entre las Drosophilidae. Los exones 3 y 4 también se conservan en A. gambiae y A. mellifera mientras que un mayor grado de variación se encuentra en el exón 5, lo que refleja la distancia evolutiva entre estos insectos. En esta región, el Apis El gen TpnT tiene un exón empalmado alternativamente adicional. Los exones 3 y 4 están claramente conservados, pero los exones 5, 5 'y el exón constitutivo 6a tienen secuencias muy diferentes, siendo más similares a las secuencias en el ortóptero. Periplaneta (Wolf 1999) y el odonato Libellula Exones de TpnT (Fitzhugh y Marden 1997 Marden et al. 1999, 2001) a pesar de la distancia evolutiva mucho mayor de estas especies de los insectos holometábolos.

Exones empalmados alternativamente en genes TpnT y TpnI. (A) Alineación de la región 5 'de los transcritos de troponina T en insectos. Conservación de aminoácidos (•), variación silenciosa () (ADNc), variación equivalente () y variación no equivalente () en relación con Drosophila melanogaster se muestran la secuencia. Estas secuencias, etiquetadas con las abreviaturas de especies de dos letras y el número de exón correspondiente (E10A Dm significa exón 10A en D. melanogaster por ejemplo), se conservan en las cuatro especies de drosofílidos (solo aparece una variación silenciosa) y también en el Anofeles y Apis exones excepto el exón 5. El Libellula (AF133521) y Periplaneta (AF133520) Las secuencias de TpnT (obtenidas de GenBank) conservan las mismas propiedades aunque las secuencias de exón alternativas muestran niveles más altos de variación. (B) Alineación y árbol filogenético de las secuencias alternativas del exón 10 de TpnT en insectos. Las ramas con valores de arranque por debajo del 70% se han colapsado en este árbol basado en cDNA. La mayoría de los cambios afectan el número de residuos fosforilables, indicado a la derecha de la alineación, con la excepción de la treonina final conservada marcada con un asterisco. (C) Alineación y árbol filogenético de las secuencias alternativas del exón 9 y 10 de TpnI en insectos. los Haemaphysalis longicornis La secuencia TpnI (AB051079), en la que no se ha descrito el exón 9, se utilizó como grupo externo.

Exones empalmados alternativamente en genes TpnT y TpnI. (A) Alineación de la región 5 'de los transcritos de troponina T en insectos. Conservación de aminoácidos (•), variación silenciosa () (ADNc), variación equivalente () y variación no equivalente () en relación con Drosophila melanogaster se muestran la secuencia. Estas secuencias, etiquetadas con las abreviaturas de especies de dos letras y el número de exón correspondiente (E10A Dm significa exón 10A en D. melanogaster por ejemplo), se conservan en las cuatro especies de drosofílidos (solo aparece una variación silenciosa) y también en el Anofeles y Apis exones excepto el exón 5. El Libellula (AF133521) y Periplaneta (AF133520) Las secuencias de TpnT (obtenidas de GenBank) conservan las mismas propiedades aunque las secuencias de exón alternativas muestran niveles más altos de variación. (B) Alineación y árbol filogenético de las secuencias alternativas del exón 10 de TpnT en insectos. Las ramas con valores de arranque por debajo del 70% se han colapsado en este árbol basado en cDNA. La mayoría de los cambios afectan el número de residuos fosforilables, indicado a la derecha de la alineación, con la excepción de la treonina final conservada marcada con un asterisco. (C) Alineación y árbol filogenético de las secuencias alternativas del exón 9 y 10 de TpnI en insectos. los Haemaphysalis longicornis La secuencia TpnI (AB051079), en la que no se ha descrito el exón 9, se utilizó como grupo externo.

Las secuencias de los exones 10A y 10B de TpnT mutuamente excluyentes (fig.2B) también están bien conservados entre Drosophilidae. Se encuentran mayores diferencias en Anofeles y Apis. Las variaciones no equivalentes en el exón 10A se distribuyen por igual en todo el exón, pero menos en el exón 10B. Curiosamente, aparece un mayor número de residuos de treonina en el exón de insecto 10A que en el exón 10B, pero sólo la última treonina del exón 10A se conserva en todos los insectos analizados. Drosophila Las isoformas de TpnT se fosforilan fácilmente in vivo (Domingo et al. 1998), precisamente en la secuencia codificada por el exón 10A (Nongthomba y Sparrow, comunicación personal).

En cuanto a los genes TpnI, los exones constitutivos se conservan casi estrictamente y la secuencia de los exones alternativos 9 y 10 (fig.2C) reflejan una situación similar a la de los exones 10A y 10B de TpnT. Aunque sabemos que las secuencias empalmadas alternativamente son cortas, se pueden construir árboles filogenéticos basados ​​en la comparación entre las secuencias codificadas por estos exones. Aunque esta información no es suficiente para establecer el origen evolutivo de estos exones, se puede utilizar para detectar cómo han ido cambiando en diferentes grupos de insectos cuando los datos de todos los exones se analizan juntos. En ambos genes Tpn, uno de los exones duplicados (exón 10A de TpnT y exón 9 de TpnI) parece estar menos conservado que el otro (exón 10B de TpnT y exón 10 de TpnI), mostrando patrones evolutivos similares en cada uno de los tres grupos de insectos analizados. Por tanto, es probable que la duplicación de estos exones alternativos de TpnT y TpnI pueda haber ocurrido en el origen del desarrollo de tipo holometábolos. De acuerdo con esta idea, solo se ha encontrado un único exón 10 de TpnT con características de secuencia intermedia en el hemimetabolismo. Periplaneta americana y Libellula pulchella. Además, solo se ha encontrado un exón 9/10 en el arácnido Haemaphysalis longicornis Gen TpnI (You et al. 2001). Curiosamente, el exón 9 de TpnI en Drosophilidae no contiene un codón de parada completo, que se forma mediante el corte y empalme de su último nucleótido con las dos primeras bases del exón 10 (Barbas et al. 1993). Esta característica no se observa en Anofeles o Apis, donde los codones de terminación y las UTR 3 'se encuentran en los exones 9 y 10.

También se han analizado las secuencias del exón 6 mutuamente excluyentes de TpnI. En un árbol filogenético de consenso basado en secuencias de nucleótidos del exón 6 (fig.3A), los valores bajos de bootstrap en la base del árbol del insecto sugieren un origen antiguo para estos eventos de duplicación, pero el árbol admite una clara diferenciación del exón 6a del exón 6b. Los exones 6b son lo suficientemente variables como para ser discriminativos filogenéticamente. Los exones 6a son tan diferentes entre sí que los Apis los exones parálogos 6a1 y 6a2 están tan relacionados entre sí como con sus supuestos exones ortólogos drosófilos (ver la politomía en la rama del exón 6a). La presencia de un solo exón 6a en Anofeles y la pérdida de la señal de corte y empalme del donante canónico del exón 6a2 en las Drosophilidae también son dignas de mención. En una secuencia de alineación (fig.3B), se puede ver que cada Anofeles y Apis el exón 6 está tan estrechamente relacionado entre sí como con los de Drosophilidae. Finalmente, el exón 3 de Drosophilidae TpnI (fig.4A) son esencialmente secuencias ricas en alanina / prolina. Todos muestran el motivo PAANGKA que aparece repetido varias veces en diferentes posiciones en el D. melanogaster, D. subobscura, y D. virilis extensiones. Este dominio está ausente en Anofeles y en Apis TpnIs, donde se encuentra un exón constitutivo 3 muy corto.

Árbol filogenético y alineación del exón 6 de TpnI empalmado diferencialmente. (A) Las ramas con valores de arranque por debajo del 70% se han colapsado en este árbol basado en cDNA. Los exones 6b1 y 6b2 están claramente separados, pero no se puede extraer una filogenia del exón 6a del árbol. (B) Alineación de las secuencias del exón 6 traducidas (34 aa traducidos del último nucleótido del exón 5 más los nucleótidos del exón 6), flanqueadas por las secuencias de corte y empalme cuando están disponibles. Las secuencias se designan mediante la abreviatura de especie de dos letras y el número de exón correspondiente (Dm E6b1, por ejemplo). Los exones 6a son los más variables, habiendo perdido incluso la secuencia del donante de corte y empalme canónico (letras en negrita y cursiva en la figura) en los exones drosophilid 6a2.

Árbol filogenético y alineación del exón 6 de TpnI empalmado diferencialmente. (A) Las ramas con valores de arranque por debajo del 70% se han colapsado en este árbol basado en cDNA. Los exones 6b1 y 6b2 están claramente separados, pero no se puede extraer una filogenia del exón 6a del árbol. (B) Alineación de las secuencias del exón 6 traducidas (34 aa traducidos del último nucleótido del exón 5 más los nucleótidos del exón 6), flanqueadas por las secuencias de corte y empalme cuando están disponibles. Las secuencias se designan mediante la abreviatura de especie de dos letras y el número de exón correspondiente (Dm E6b1, por ejemplo). Los exones 6a son los más variables, habiendo perdido incluso la secuencia del donante de corte y empalme canónico (letras en negrita y cursiva en la figura) en los exones drosophilid 6a2.

Alineación de las extensiones ricas en troponina I específica de IFM y tropomiosina alanina / prolina. (A) Aunque las secuencias del exón 3 de TpnI no se conservan perfectamente incluso en Drosophilidae, se conserva la heptada PAANGKA (recuadro sombreado). Se repite en algunas especies rodeadas por una región rica en alanina / prolina. Esta secuencia está ausente en Anofeles y Apis porque sus genes TpnI carecen de un exón 3 con estas propiedades. (B) La extensión TpnH está codificada por un único Tm1 exón del gen en Anofeles, mientras que en el Apis Gen TpnI involucra hasta tres exones del gen 3 '(separados en las tres filas del alineamiento), todos ellos codificando una secuencia rica en alanina / prolina con el motivo APPAEGA (recuadro sombreado). Se ha encontrado una secuencia equivalente en el Lethocerus Gen TpnI (AJ621044) y se incluye como secuencia final en la alineación.

Alineación de las extensiones ricas en troponina I específica de IFM y tropomiosina alanina / prolina. (A) Aunque las secuencias del exón 3 de TpnI no se conservan perfectamente incluso en Drosophilidae, se conserva la heptada PAANGKA (recuadro sombreado). Se repite en algunas especies rodeadas por una región rica en alanina / prolina. Esta secuencia está ausente en Anofeles y Apis porque sus genes TpnI carecen de un exón 3 con estas propiedades. (B) La extensión TpnH está codificada por un único Tm1 exón del gen en Anofeles, mientras que en el Apis Gen TpnI involucra hasta tres exones del gen 3 '(separados en las tres filas del alineamiento), todos ellos codificando una secuencia rica en alanina / prolina con el motivo APPAEGA (recuadro sombreado). Se ha encontrado una secuencia equivalente en el Lethocerus Gen TpnI (AJ621044) y se incluye como secuencia final en la alineación.

Se han localizado tres nuevos exones aguas abajo del exón 10 en el Apis Gen TpnI. Estos exones pueden empalmarse para producir un Apisisoforma TpnI específica que contiene una extensión C t que codifica una secuencia APPAEGA repetitiva, a través de un nuevo sitio donante de empalme de GT en el exón 10, ubicado 25 pb antes del codón de terminación. Esta extensión es claramente similar a la extensión rica en alanina / prolina de la tropomiosina específica de IFM de gran peso molecular en los dípteros, tanto en secuencia como en longitud de proteína (fig.4B). Curiosamente, el Apis El gen de la tropomiosina Tm1 carece de este tipo de secuencia (Mateos et al., resultados no publicados). Se encuentra una extensión repetitiva similar de alanina / prolina en el extremo 3 'de una transcripción del gen TpnI del hemípteros Lethocerus (Qiu et al. 2003 y secuencia AJ621044).

El patrón de expresión de los genes TpnI y TpnT se conserva en Drosophilidae

Los perfiles de expresión de las isoformas de TpnI y TpnT en D. subobscura y D. virilis se detectaron mediante técnicas de RT-PCR (datos no publicados). Todas las transcripciones previamente identificadas en D. melanogaster (Barbas et al. 1993 Benoist et al. 1998) se detectaron en el segundo estadio larvario y en estadios tardíos de pupa de estos drosófilos. Las combinaciones de los exones alternativos 3, 4 y 5 de la troponina T aparecieron en larvas o en transcripciones de músculos abdominales adultos en patrones característicos de cada músculo. Las principales transcripciones de los músculos torácicos adultos no contienen ninguno de estos exones alternativos. La inclusión del exón 9 de la troponina I se encuentra exclusivamente en las transcripciones de la musculatura adulta, y se acompaña del exón 3 en la transcripción torácica principal. Los cuatro tipos de exón 6 se detectaron a niveles variables en todos los tejidos estudiados, siendo los que contenían el exón 6b1 los más expresados ​​en IFM (Barbas et al. 1993).

El descubrimiento del nuevo exón 10A de TpnT condujo a un estudio de su patrón de expresión. Una única sonda para el exón constitutivo 6 y cuatro sondas específicas para los exones 10A o 10B (fig.5A) se utilizaron para RT-PCR. En los embriones, solo se detectó la transcripción que contiene el exón 10B, mientras que en los ARN adultos completos, aparecen transcripciones que contienen 10A o 10B.

Diferencias en el perfil de expresión de las transcripciones de TpnT y TpnI en el Drosophila melanogaster musculatura. Separaciones en gel de agarosa al 1,2% de RT-PCR. Cada transcripción detectada por PCR como una banda está marcada con una flecha etiquetada con el nombre del gen amplificado y su composición de exón. (A) Patrón de expresión del exón 10 mutuamente excluyente detectado en extracciones de ARN adulto o embrionario con cuatro cebadores específicos del exón 10A o 10B (10A1, 10 A2, 10B1y 10B2). (B) Patrones de expresión en partes del cuerpo adultas (cabeza, IFM, TDT y abdomen). Usando sondas para TpnT exón 6 y 10A (10A2 sonda) o 10B (10B1 sonda), se muestra el patrón de expresión del exón 10. El exón 10B se expresa en todos los músculos del adulto excepto en el IFM. El exón 10A es el único expresado en el IFM, pero también se expresa en los músculos TDT. (C) Se utilizaron sondas para la región 3 'del gen TpnI en RT-PCR (exones 8-9 y 8-10). El exón 9 usa los dos primeros residuos del exón 10 para generar un codón de parada, por lo que la sonda del exón 10 lo detecta como una banda inferior, las transcripciones carecen del exón 9 y, como una banda superior, las transcripciones que contienen el exón 9. Por lo tanto, el exón 9 es expresado principalmente en IFM y solo débilmente en músculos TDT. (D) Utilizando las sondas del exón 2 y del exón 9 para TpnI, se puede ver que el exón 3 sólo aparece expresado en gran medida en los músculos torácicos, incluido siempre el exón 9. No se muestran las líneas de control RT-negativo.

Diferencias en el perfil de expresión de las transcripciones de TpnT y TpnI en el Drosophila melanogaster musculatura. Separaciones en gel de agarosa al 1,2% de RT-PCR. Cada transcripción detectada por PCR como una banda está marcada con una flecha etiquetada con el nombre del gen amplificado y su composición de exón. (A) Patrón de expresión del exón 10 mutuamente excluyente detectado en extracciones de ARN adulto o embrionario con cuatro cebadores específicos del exón 10A o 10B (10A1, 10 A2, 10B1y 10B2). (B) Patrones de expresión en partes del cuerpo adultas (cabeza, IFM, TDT y abdomen). Usando sondas para TpnT exón 6 y 10A (10A2 sonda) o 10B (10B1 sonda), se muestra el patrón de expresión del exón 10. El exón 10B se expresa en todos los músculos del adulto excepto en el IFM. El exón 10A es el único expresado en el IFM, pero también se expresa en los músculos TDT. (C) Se utilizaron sondas para la región 3 'del gen TpnI en RT-PCR (exones 8-9 y 8-10). El exón 9 usa los dos primeros residuos del exón 10 para generar un codón de parada, por lo que la sonda del exón 10 lo detecta como una banda inferior, las transcripciones carecen del exón 9 y, como una banda superior, las transcripciones que contienen el exón 9. Por lo tanto, el exón 9 es expresado principalmente en IFM y solo débilmente en músculos TDT. (D) Utilizando las sondas del exón 2 y del exón 9 para TpnI, se puede ver que el exón 3 sólo aparece expresado en gran medida en los músculos torácicos, incluido siempre el exón 9. No se muestran las líneas de control RT-negativo.

La detección del exón 10A fue particularmente fuerte en el tórax, lo que sugiere un papel específico de la secuencia codificada por este exón en la musculatura relacionada con el vuelo (datos no mostrados). Las sondas específicas del exón 10A y 10B detectaron, mediante RT-PCR, el exón 10B clásico en la cabeza, el abdomen y las fibras de TDT diseccionadas (fig.5B). La expresión del exón 10A se encontró casi exclusivamente en el producto de RT-PCR de ARN extraído de fibras IFM y TDT, aunque también se detectó cierta expresión residual en el abdomen. En consecuencia, IFM TpnT contiene secuencias codificadas solo por el exón 10A, mientras que los músculos TDT contienen una mezcla de transcripciones con el exón 10A o 10B. El mismo enriquecimiento torácico de las transcripciones del exón 10A se obtuvo en D. subobscura y D. virilis.

Se detectaron exones empalmados alternativamente de TpnI usando varias combinaciones de sondas. El exón 9 está presente en las transcripciones TDT e IFM (fig.5C), pero mientras que en los IFM es el único que se expresa, en TDT se reemplaza casi por completo por las transcripciones que contienen el exón 10. El uso de sondas para la región codificante completa (del exón 2 al exón 9/10) en las partes del cuerpo adultas mostró que el exón 3 empalmado alternativamente se expresa en TDT / IFM, pero solo está presente en las transcripciones que también incorporan el exón 9 (fig.5D).

Perfil de expresión de los genes TpnT y TpnI en A. mellifera

Se ha realizado el mismo procedimiento con la abeja melífera para descubrir si ocurren los mismos patrones de abundancia de isoformas. El perfil de expresión de las transcripciones de TpnT durante A. mellifera desarrollo (fig.6A) muestra que los músculos larvarios contienen una mezcla de transcripciones con exones alternativos 3, 4 y 5 'o exones 3 y 4. Los IFM contienen una isoforma codificada por una transcripción que carece de todos los exones empalmados alternativamente de la región 5'. Otros músculos adultos contienen una mezcla de transcripciones que contienen los exones 3, 4, 5 y 5 ′ o 3, 4 y 5. En relación con la mitad 3 ′ de los genes, se encontraron transcripciones que contienen el exón 10B en todos los músculos excepto en IFM, donde solo se detecta marginalmente (músculo de vuelo indirecto dorsoventral) o no se detecta en absoluto (músculo de vuelo indirecto dorsolateral). Las transcripciones que contienen el exón 10A son específicas del tórax de adultos, similares a los resultados de las drosofílidas (ver más arriba).

Perfil de expresión de las transcripciones de TpnI y TpnT en Apis mellifera. Cada transcripción detectada por PCR como una banda está marcada con una flecha etiquetada con el nombre del gen amplificado y su composición de exón. Los carriles vacíos adyacentes a cada carril de PCR son controles negativos (ARNm sin transcripción inversa). (A) Perfil de expresión de troponina T durante el desarrollo (estadios larvarios L1 y L2 y pupas P1 y P2) y en los músculos del tórax (músculos dorsoventrales de vuelo indirecto [DV-IFM], dorsolaterales de vuelo indirecto [DL-IFM], piernas y otros músculos torácicos músculos) de Apis. Apis TpnT muestra un patrón de expresión similar al descrito en Drosophila. (B) Se muestra el patrón de expresión de TpnI en la misma muestra. Los exones alternativos, 9 y 10, que contienen ambos un codón de terminación adecuado y señales de terminación, se expresan en diferentes niveles en todos los músculos y etapas. Usando sondas del exón 4 y el exón H1 del Apis TpnI, hemos detectado un patrón de expresión específico de IFM para esta isoforma de TpnH en himenópteros. Los cuatro exones 6 identificados se expresan en los transcritos de TpnI (detectados por PCR interna usando sondas internas específicas del tipo del exón 6 en una segunda PCR usando la banda de fracción P2 como sustrato de ADN), excepto en el transcrito específico de IFM donde solo se encuentran los exones 6b detectado. (C) Los experimentos de extensión de cDNA de amplificación rápida 3 '(RACE) se realizaron con muestras de tórax, IFM y larvas para detectar las paradas de transcripción en el Apis Gen TpnI. Las transcripciones que representan ocho sitios de parada diferentes se han representado proporcionalmente a la izquierda, con su tamaño indicado y diferentes estilos de flechas (según las transcripciones del último exón, línea de puntos para el exón 9, línea continua para el exón 10 y línea discontinua para el exón H). la banda correspondiente en los geles de electroforesis RACE. Tres de ellos (una transcripción para cada grupo) son los principales utilizados en los músculos torácicos (sus longitudes se muestran dentro de los círculos), pero la transcripción que contiene los exones de TpnH está ausente en los músculos larvales. Se muestran los carriles de control negativo RACE (carriles -).

Perfil de expresión de las transcripciones de TpnI y TpnT en Apis mellifera. Cada transcripción detectada por PCR como una banda está marcada con una flecha etiquetada con el nombre del gen amplificado y su composición de exón. Los carriles vacíos adyacentes a cada carril de PCR son controles negativos (ARNm sin transcripción inversa). (A) Perfil de expresión de troponina T durante el desarrollo (estadios larvarios L1 y L2 y pupas P1 y P2) y en los músculos del tórax (músculos dorsoventrales de vuelo indirecto [DV-IFM], dorsolaterales de vuelo indirecto [DL-IFM], piernas y otros músculos torácicos músculos) de Apis. Apis TpnT muestra un patrón de expresión similar al descrito en Drosophila. (B) Se muestra el patrón de expresión de TpnI en la misma muestra. Los exones alternativos, 9 y 10, que contienen ambos un codón de terminación adecuado y señales de terminación, se expresan en diferentes niveles en todos los músculos y etapas. Usando sondas del exón 4 y el exón H1 del Apis TpnI, hemos detectado un patrón de expresión específico de IFM para esta isoforma de TpnH en himenópteros. Los cuatro exones 6 identificados se expresan en los transcritos de TpnI (detectados por PCR interna usando sondas internas específicas del tipo del exón 6 en una segunda PCR usando la banda de fracción P2 como sustrato de ADN), excepto en el transcrito específico de IFM donde solo se encuentran los exones 6b detectado. (C) Los experimentos de extensión de cDNA de amplificación rápida 3 '(RACE) se realizaron con muestras de tórax, IFM y larvas para detectar las paradas de transcripción en el Apis Gen TpnI. Las transcripciones que representan ocho sitios de parada diferentes se han representado proporcionalmente a la izquierda, con su tamaño indicado y diferentes estilos de flechas (según las transcripciones del último exón, línea de puntos para el exón 9, línea continua para el exón 10 y línea discontinua para el exón H). la banda correspondiente en los geles de electroforesis RACE. Tres de ellos (una transcripción para cada grupo) son los principales utilizados en los músculos torácicos (sus longitudes se muestran dentro de los círculos), pero la transcripción que contiene los exones de TpnH está ausente en los músculos larvales. Se muestran los carriles de control negativo RACE (carriles -).

El patrón de expresión de TpnI detectado mediante RT-PCR se muestra en la figura 6B. Las sondas para la región entre los exones 4 y 9 o los exones 4 y 10 revelaron que las transcripciones que contienen el exón 9 o el exón 10 se detectan en las diferentes etapas del desarrollo y en todos los músculos del adulto. Apis musculatura. A pesar de las limitaciones inherentes a estos experimentos de PCR, las transcripciones que contienen el exón 9 parecen aparecer más tarde que las que contienen el exón 10. Usando sondas para cada exón 6 y exón 8 específicos en una PCR interna de los productos amplificados anteriores, los cuatro exones 6 en ambos exones Se detectaron transcripciones que contenían 9 y el exón 10. Aunque no se realizó PCR cuantitativa, los resultados indican que los niveles máximos de expresión de los exones 6a y 10 ocurren durante las etapas larvarias, mientras que los de los exones 6b y 9 ocurren en adultos.

Finalmente, RT-PCR utilizando sondas diseñadas para amplificar la región entre el exón 4 y el exón H1 del Apis El gen TpnI mostró, como se esperaba, que un pesado Apis TpnI (troponina H) se expresa exclusivamente en el IFM (fig.6B). Esta banda se clonó y se probó su contenido en el exón 6, usando una sonda del exón 8 en combinación con una sonda específica para cada uno de los cuatro exones 6. La secuenciación de 14 clones confirmó que 7 clones contenían el exón 6b1 y los otros 7 clones contenían el exón 6b2. Además, estas transcripciones de TpnH incluyen una versión empalmada más corta del exón 10 que no pudo detectarse en ensayos de RT-PCR anteriores utilizando la sonda del exón 10. Con el fin de localizar los extremos 3 'de las transcripciones de TpnI, hemos realizado experimentos de extensión de ADNc de amplificación rápida con tres Apis Fracciones de ARN (fig.6C). Encontramos hasta ocho extremos de transcripción diferentes para el gen TpnI, pero solo tres de los principales ocurren en el ARNm de los músculos torácicos y las muestras de IFM. Dos de ellos son 3 'hasta el exón 9 y el exón 10, producen las transcripciones estándar de TpnI y también se utilizan en los músculos larvarios. El otro extremo incorpora la parte inicial del exón 10 pero se extiende a los exones H1, H2 y H3, produciendo un TpnH isoforma con una larga extensión rica en alanina / prolina. También hemos detectado una transcripción en la que el exón H1 no usa su sitio de empalme del aceptor y esto produciría una TnH isoforma con una extensión más corta rica en alanina / prolina.


Base genética, diagnóstico y manejo

Fondo: El síndrome de hipoventilación central congénita (CCHS) se caracteriza por hipoventilación alveolar y desregulación autonómica.

Objetivo: (1) Para demostrar la importancia de PHOX2B pruebas en el diagnóstico y tratamiento de pacientes con CCHS, (2) para resumir los avances recientes en la comprensión de cómo las mutaciones en el PHOX2B gen que conduce al fenotipo CCHS, y (3) para proporcionar una actualización sobre las recomendaciones para el diagnóstico y tratamiento de pacientes con CCHS.

Métodos: Se invitó a los miembros del comité sobre la base de su experiencia en CCHS y se les pidió que revisaran el estado actual de la ciencia completando búsquedas bibliográficas de forma independiente. Se llegó a un consenso sobre las recomendaciones por acuerdo entre los miembros del Comité.

Resultados: Una revisión de la literatura pertinente permitió el desarrollo de un documento que resume los avances recientes en la comprensión de CCHS y la interpretación experta de la evidencia para el manejo de los pacientes afectados.

Conclusiones: A PHOX2B Se requiere una mutación para confirmar el diagnóstico de CCHS. Conocimiento de lo específico PHOX2B la mutación ayuda a anticipar la gravedad del fenotipo CCHS. Los padres de pacientes con CCHS deben hacerse la prueba de PHOX2B mutaciones. Mantener un alto índice de sospecha en casos de hipoventilación alveolar inexplicable probablemente identificará una mayor incidencia de casos más leves de CCHS. Las opciones de manejo recomendadas destinadas a maximizar la seguridad y optimizar el resultado neurocognitivo incluyen: (1) Evaluación integral hospitalaria semestral y luego anual con (I) estudios fisiológicos durante los estados despierto y dormido para evaluar las necesidades ventilatorias durante los diferentes niveles de actividad y concentración, en todas las etapas del sueño, con respiración espontánea y con ventilación artificial, y para evaluar la respuesta ventilatoria a los desafíos fisiológicos mientras está despierto y dormido, (ii) Monitoreo Holter de 72 horas, (iii) ecocardiograma, (iv) evaluación de la desregulación del SNA en todos los sistemas de órganos afectados por el SNA, y (v) evaluación neurocognitiva formal (2) enema de bario o manometría y / o biopsia rectal de espesor total para pacientes con antecedentes de estreñimiento y (3) Imágenes para tumores de la cresta neural en individuos con mayor riesgo según PHOX2B mutación.

PHOX2B: El gen que define la enfermedad para CCHS

PHOX2B Mutaciones en CCHS

PHOX2B Genotipo / Fenotipo de CCHS

Mosaicismo en un subconjunto de padres con hijos CCHS

Herencia de CCHS y el PHOX2B Mutación

Mecanismo por el cual mutaciones en PHOX2B Resultado del gen en el fenotipo de CCHS

Un modelo de medicina autónoma transicional y traslacional

En 1999, la American Thoracic Society publicó la primera Declaración sobre el síndrome de hipoventilación central congénita (CCHS) (1). Desde entonces, el mundo de CCHS ha explotado con (1) el descubrimiento de que el homeobox 2B pareado (PHOX2B) es el gen que define la enfermedad de CCHS (2-5) (2) identificación de un patrón de herencia autosómico dominante (3, 5-7) (3) demostración de un PHOX2B Relación genotipo-fenotipo CCHS pertinente a dependencia ventilatoria (3, 5), dismorfología facial (8), asistolia cardíaca (9) y enfermedad de Hirschsprung y neuroblastoma (6, 7) (4) identificacion de PHOX2B mutaciones en adultos CCHS y niños mayores (10-17) cuyo diagnóstico fue "perdido" o no fue aparente en el período neonatal, lactancia y niñez temprana (5) documentación de mosaicismo en 5 a 10% de los padres de niños con CCHS (3, 6) y (6) mejor comprensión de los mecanismos específicos mediante los cuales PHOX2B resulta en el fenotipo CCHS (6, 18-21). El propósito de una nueva declaración ATS sobre CCHS es ayudar al médico a optimizar la atención al paciente que se adaptará específicamente al conocimiento del individuo. PHOX2B genotipo / mutación, y para ofrecer asesoramiento genético. Finalmente, todas las opciones de manejo se abordarán con los objetivos a largo plazo de mejorar la calidad de vida de PHOX2B personas con CCHS confirmadas por mutación y para obtener una mejor comprensión del sistema nervioso autónomo (SNA) en la salud y la enfermedad. Éstos incluyen (1) evaluación hospitalaria semestral y luego anual con (I) estudios fisiológicos durante los estados despierto y dormido para evaluar las necesidades ventilatorias durante los diferentes niveles de actividad y concentración, en todas las etapas del sueño, con respiración espontánea y con ventilación artificial, y para evaluar la respuesta ventilatoria a los desafíos fisiológicos mientras está despierto y dormido, (ii) Monitoreo Holter de 72 horas, (iii) ecocardiograma, (iv) evaluación de la desregulación del SNA en todos los sistemas de órganos afectados por el SNA, y (v) evaluación neurocognitiva formal (2) enema de bario o manometría y / o biopsia rectal de espesor total para pacientes con antecedentes de estreñimiento y (3) Imágenes para tumores de la cresta neural en individuos con mayor riesgo según PHOX2B mutación.

Los miembros del comité fueron invitados sobre la base de su experiencia en la atención de pacientes con CCHS en términos de atención clínica, investigación clínica o investigación científica básica. Se incluyó representación de las comunidades pediátrica y de adultos. La intención era la representación internacional. Se pidió a los miembros del comité que revisaran el estado actual de la ciencia completando de forma independiente búsquedas bibliográficas utilizando Pub Med y OVID. A cada miembro del comité se le pidió que evaluara la literatura identificada, proporcionara una crítica de los artículos y calificara la importancia de los artículos individuales. Los artículos y las críticas mejor valorados se integraron en el documento de trabajo. Se alcanzó un consenso sobre las recomendaciones entre los miembros del Comité.

Informar al médico, padre, cuidador y proveedor de atención médica que un PHOX2B la mutación es un requisito para la confirmación del diagnóstico de CCHS.

Para mejorar el conocimiento general sobre PHOX2B como el gen que define la enfermedad de CCHS. El lector aprenderá que (I) aproximadamente el 90% de los individuos con el fenotipo CCHS son heterocigotos para una mutación repetida de expansión de polialanina en el PHOX2B gen,ii) aproximadamente el 10% de los individuos con CCHS son heterocigotos para una mutación sin sentido, sin sentido o de cambio de marco en el PHOX2B gen,iii) Se deben buscar otros diagnósticos que no sean de CCHS si un PHOX2B no se encuentra la mutación.

Presentar la oportunidad de anticipar el fenotipo CCHS basado en el PHOX2B genotipo / mutación.

Educar a los médicos de que la CCHS ya no se diagnostica exclusivamente en el período neonatal, como ahora se describe entre los niños pequeños, los niños y los adultos.

Centrarse en el patrón de herencia autosómico dominante del PHOX2B mutación en CCHS, el hallazgo de mosaicismo en 5 a 10% de los padres y la importancia de evaluar a ambos padres de cada sujeto con CCHS.

Mejorar la comprensión de los mecanismos específicos mediante los cuales PHOX2B da como resultado el fenotipo CCHS.

Actualizar la información sobre el tratamiento disponible y las opciones de atención médica domiciliaria.

Reconocer que CCHS es un modelo para la medicina autonómica traslacional y transicional. Además de utilizar el PHOX2B mutación genética para optimizar el manejo del paciente, será necesario que los médicos continúen cuidando a estos pacientes especiales a medida que maduran hasta la edad adulta.

El CCHS fue descrito por primera vez en 1970 por Robert Mellins y colegas (22). A pesar de la multitud de informes de casos, no se publicaron grandes series hasta 1992 (23). La Declaración de la ATS de 1999 sobre CCHS estimó “aproximadamente entre 160 y 180 niños vivos con CCHS en todo el mundo”, pero advirtió que estas cifras “se consideran una subestimación” (1). En 2009, los laboratorios colectivos de Estados Unidos, Francia, Italia, Japón, Alemania, Taiwán, China, Países Bajos, Chile, Reino Unido y Australia han diagnosticado casi 1.000 casos con PHOX2B CCHS confirmada por mutación. Incluso ahora, se reconoce que esto es una subestimación, ya que los individuos con el fenotipo más leve están infradiagnosticados. Aunque la CCHS se diagnostica típicamente durante el período neonatal, informes recientes indican que las personas pueden ser diagnosticadas en la infancia (5, 6, 17, 24-26) y la edad adulta (10-17, 26), dependiendo de la PHOX2B genotipo y la curiosidad intelectual del paciente, la familia y el equipo médico. Independientemente de la edad en el momento de la presentación, las personas con CCHS serán diagnosticadas clínicamente en ausencia de enfermedad pulmonar, cardíaca o neuromuscular primaria o una lesión identificable del tronco encefálico que podría explicar la enfermedad. completo fenotipo que incluye la desregulación del sistema nervioso autónomo (ANSD). Los individuos con CCHS tienen típicamente volúmenes tidales diminutos y frecuencias respiratorias monótonas despiertas y dormidas (1), aunque la hipoventilación alveolar más profunda ocurre principalmente durante el sueño. Como resultado de la hipoventilación, estos individuos se volverán hipoxémicos e hipercárbicos, pero generalmente carecen de la capacidad de respuesta a estos desafíos endógenos en términos de ventilación y excitación durante el sueño, y carecen de la percepción de asfixia durante la vigilia con y sin esfuerzo (1). Las afecciones asociadas con CCHS que reflejan ANSD anatómico incluyen enfermedad de Hirschsprung (HSCR) y tumores de origen de la cresta neural, además de un espectro de síntomas compatibles con ANSD fisiológico, que incluyen respuesta pupilar a la luz disminuida, dismotilidad esofágica, episodios de contención de la respiración, temperatura corporal basal reducida, sudoración profusa esporádica, falta de percepción de la disnea, percepción alterada de la ansiedad y falta de respuesta fisiológica a los desafíos del ejercicio y los factores estresantes ambientales (1, 23, 27–39). CCHS es una enfermedad de por vida, que plantea preguntas clave que incluyen: (1) ¿Cambiará el fenotipo con el avance de la edad en función de la PHOX2B mutación, edad en el momento del diagnóstico y adecuación del tratamiento? y (2) ¿Las estrategias de intervención serán efectivas considerando la naturaleza de la mutación y su momento en términos de desarrollo embriológico? Como el objetivo de esta Declaración no es proporcionar una revisión exhaustiva de CCHS, se remite al lector a revisiones recientes (www.genereviews.org y Referencias 40 y 41).

Los indicios sobre la familiaridad de CCHS surgieron entre la década de 1980 y 2001. Los datos de recurrencia familiar incluyen un informe de cada una de las gemelas monocigóticas afectadas (42), hermanas (43), hermanos varón-mujer (23, 44) y medio hermanos varón-mujer (45) con CCHS. En el prePHOX2B/ CCHS, cinco mujeres diagnosticadas con CCHS en su propia infancia dieron a luz a dos bebés con CCHS definido, una con probable CCHS confundida por inmadurez severa y displasia broncopulmonar, y una con CCHS de inicio tardío (46, 47). Un informe de un niño con CCHS nacido de una mujer que tuvo neuroblastoma cuando era un bebé (48) agregó a la premisa de un componente genético transmitido en el espectro fenotípico de ANSD y CCHS. Además, la ANSD se estudió en un diseño de familia de casos y controles (27, 28), que proporcionó una importante evidencia confirmatoria de una base genética para la CCHS y, por lo tanto, se considera la manifestación más grave de una ANSD general (1, 27, 44), aunque el papel de PHOX2B en la categoría más amplia de ANSD sigue siendo desconocido.

La mayoría de los primeros estudios, realizados en busca de la base genética de CCHS, se restringieron a genes que se sabe están relacionados con HSCR. Se informó que veinte pacientes tenían mutaciones que alteran las proteínas en el receptor tirosina quinasa (RETIRADO) (49-53), factor neurotrófico derivado de células gliales (GDNF) (49), vía de señalización de endotelina 3 (EDN3) (52, 54), factor neurotrófico derivado del cerebro (BDNF) (55), gen homólogo de asqueto-escudo humano (HASH1) (4, 56), gen homeobox pareado 2A (PHOX2A) (4), GFRA1 (4), proteína morfogénica ósea 2 (BMP2) (3) y la enzima convertidora de endotelina 1 (ECE1) (3). Otros tres informes indican una ausencia de RETIRADO (57) y RNX mutaciones (58, 59).

En 2003, PHOX2B se descubrió que es el gen que define la enfermedad de CCHS (2, 3). PHOX2B codifica un factor de transcripción de homeodominio altamente conservado que se sabe que juega un papel clave en el desarrollo de circuitos reflejos ANS en ratones (60, 61). PHOX2B contiene una secuencia repetida de 20 alaninas en el exón 3, que Amiel y sus colegas informaron que contiene duplicaciones en marco de 15 a 27 nucleótidos, lo que lleva a la expansión del tracto repetido a 25 a 29 alaninas en el alelo afectado en 18 de 29 (62 %) Casos franceses de CCHS (2). Estas expansiones parecían ser de novo en la medida en que no estuvieron presentes en ocho grupos de padres de los casos de CCHS. Dos de 29 (7%) casos de CCHS tenían mutaciones de cambio de marco. En conjunto, el 69% de los 29 pacientes franceses eran heterocigotos durante un PHOX2B mutación, pero ninguno de los controles había PHOX2B mutaciones. Amiel y colegas (2) también demostraron PHOX2B expresión en embriones humanos tempranos en circuitos neuronales autónomos centrales y en derivados de la cresta neural periférica.

Al mismo tiempo que los estudios franceses, Weese-Mayer y sus colegas (3) se centraron en los genes implicados en la embriología temprana del SNA (homólogo de asqueto-escudo de mamífero-1 [MASH1], BMP2, engrailed-1 [EN1], TLX3, ECE1, endotelina-1 [EDN1], y PHOX2A). Aunque no se encontraron mutaciones nuevas que causen enfermedades en ninguno de estos genes en una cohorte de 67 casos de CCHS, Weese-Mayer y colegas (3) identificaron heterocigotos PHOX2B exón 3 expansiones de repeticiones de polialanina de 25 a 33 repeticiones en 65 de 67 (97%) niños con el fenotipo CCHS. De los dos casos restantes de CCHS, una mutación sin sentido (codón de parada prematuro) en PHOX2B se identificó en un paciente y más tarde se descubrió que el otro tenía una expansión de repetición de polialanina en PHOX2B después de que se resolvió una confusión de muestras en el laboratorio de origen (7). Colectivamente, Weese-Mayer y sus colegas (3) identificaron mutaciones en el exón 3 del PHOX2B gen en el 100% de los 67 niños con el fenotipo CCHS, lo que indica que PHOX2B es el gen que define la enfermedad en CCHS. Ninguno de los PHOX2B Las mutaciones de expansión estaban presentes en 67 controles emparejados por género / etnia. Este estudio también señaló (1) una asociación entre la duración de la expansión de polialanina y la gravedad de la disfunción autonómica (2) mosaicismo en 4 de 97 padres de casos de CCHS, lo que sugiere que no todos PHOX2B ocurren mutaciones de novo (3) herencia autosómica dominante del PHOX2B mutación y el fenotipo CCHS de casos CCHS y (4) herencia autosómica dominante del PHOX2B mutación de los padres mosaico. Además, estos autores (3) establecieron el primer ensayo clínicamente disponible para el diagnóstico de CCHS utilizando un método simple y preciso para detectar y dimensionar la secuencia repetida asociada con la expansión del tracto de polialanina (patente patentada de Rush University Medical Center, Chicago, IL donada a fideicomiso caritativo y procede de PHOX2B La prueba de detección respalda la investigación de CCHS), que también podría usarse para el diagnóstico prenatal, las pruebas familiares y el diagnóstico de personas con síntomas relevantes.

Posterior a los estudios anteriores, PHOX2B expansiones de repetición de polialanina se encontraron en 4 (40%) y un PHOX2B mutación de cambio de marco de inserción en 1 (10%) de 10 casos de CCHS en Japón (4). Se demostró que la expansión era de novo en 2 casos. Sasaki y sus colegas (4) utilizaron la misma metodología que los franceses (2) y también subdetectaron PHOX2B casos de expansión como se informó en 2005 (62). En 2004, Matera y colegas (5) identificaron heterocigotos PHOX2B mutaciones de expansión de polialanina de 25 a 33 repeticiones en 21 (88%) y mutaciones de desplazamiento de marco heterocigotas en 2 (8%) de 24 casos de CCHS de Italia, Alemania y los Países Bajos. Este estudio confirmó la correlación entre el tamaño de la PHOX2B alelo expandido y la gravedad del fenotipo respiratorio y síntomas asociados (3). Matera y sus colegas también demostraron que en las reacciones en cadena de la polimerasa estándar, el alelo expandido asociado a CCHS, especialmente aquellos con 30 a 33 alaninas, puede permanecer sin ser detectado debido a la región de polialanina rica en GC de PHOX2B Por lo tanto, la PHOX2B La tasa de mutación puede subestimarse como resultado de la pérdida de alelos inducida por amplificación. Usando ensayos diseñados para amplificar regiones ricas en GC, Trang y sus colegas (63) (re) analizaron 34 de los pacientes franceses e identificaron un PHOX2B mutación en el 91% de los casos, y Trochet et al. (6) encontraron PHOX2B mutaciones en el 93% de 174 sujetos con CCHS de múltiples nacionalidades, incluidos 7 de 9 pacientes "mutación negativos" informados por Amiel y colegas en 2003 (2). Berry-Kravis y colegas (7) y Weese-Mayer y colegas (64) informaron PHOX2B mutaciones en 184 sujetos (en 2006) y colectivamente más de 350 sujetos (en 2008) con CCHS, respectivamente (100% de sensibilidad y especificidad de detección), en una cohorte principalmente de los Estados Unidos, con un 10% de pacientes del extranjero.

Como se resumió anteriormente (40, 41) (www.genereviews.org), el rango para el número de repeticiones en el PHOX2B La expansión de polialanina en el alelo afectado en pacientes con CCHS es de 24 a 33 (2–7, 13, 15–17, 25, 26, 65–70). No se encontraron mutaciones de expansión repetida de polialanina (PARM) en 482 controles de las publicaciones citadas anteriormente ni entre 1520 individuos sanos en Taiwán (67). Se han informado variantes de contracción en marco (con 7, 13, 14 o 15 repeticiones en el tracto de repetición de polialanina) en tres casos de CCHS (3, 7, 71) que albergan una mutación adicional de repetición de expansión de polialanina o una mutación de repetición no polialanina (NPARM ) pero también se encuentran en aproximadamente el 3% de los controles aparentemente normales (2, 3, 5, 72, 73), padres de CCHS (3, 16, 71) y un pequeño subconjunto de pacientes con síntomas vagos que sugieren desregulación autónoma y / o hipoventilación esporádica, o eventos aparentemente potencialmente mortales, pero no la constelación de síntomas característicos de CCHS (71). A PHOX2B Se observó una mutación de expansión repetida de polialanina que segrega la enfermedad en 9 de 16 pacientes con RETIRADO, GDNF, BDNF, HASH1, y GFRA1 mutaciones coincidentes, lo que indica que PHOX2B es el gen que define la enfermedad en estos niños.

Una mutación en el PHOX2B El gen es un requisito para el diagnóstico de CCHS. Más del 90% de los casos de CCHS serán heterocigotos para un PARM en marco que codifica de 24 a 33 alaninas en la proteína mutada y produce genotipos de 20/24 a 20/33 (el genotipo normal se denominaría 20/20). Aproximadamente el 10% restante de los pacientes con un fenotipo de CCHS clásico serán heterocigotos para un NPARM (74) (incluidos errores de sentido, sin sentido y desplazamiento de marco) en el PHOX2B gene. Los genotipos 20/25, 20/26 y 20/27 son los más comunes, aunque mensualmente se identifican números cada vez mayores de mutaciones incluso menos comunes (ver un histograma de todos los datos publicados, así como todos los datos actuales de los autores a finales de 2009 en la Figura 1).

Figura 1. Número de PHOX2B mutaciones repetidas de polialanina por genotipo. Estos datos representan toda la literatura publicada, así como los datos actuales proporcionados por los autores de la Declaración para las mutaciones repetidas de polialanina (PARM) y las mutaciones repetidas sin polialanina (NPARM). Los genotipos más comunes son 20/25, 20/26 y 20/27. Adaptado con permiso de la Referencia 41.

Se han informado NPARM (74) en asociación con CCHS por grupos en los Estados Unidos (3, 7, 20, 41, 64), Italia (5, 16, 18), Japón (4), Francia (2, 6, 13 , 75), Alemania (50, 69, 76), Australia (77), Países Bajos (78), China (79) y Taiwán (67, 80). Hasta el momento, 76 personas con CCHS y NPARM en PHOX2B Se han descrito en todo el mundo, y las mutaciones incluyen predominantemente mutaciones de cambio de marco (59/76, 78%), pero también sin sentido (3/76, 4%), sin sentido (12/76, 16%) y sin sentido con alteración del codón de terminación (2 / 76, 3%) (ver Figura 2 para un esquema de todos los datos publicados, así como todos los datos actuales de los autores de la Declaración). La mayoría de los NPARM asociados a CCHS se encuentran al final del exón 2 o en el exón 3 (Figura 2).

Figura 2. Esquema para el PHOX2B gen con ubicación de todas las mutaciones asociadas a CCHS descritas hasta la fecha en PHOX2B. Todas las mutaciones repetidas de polialanina (PARM) se encuentran dentro del segundo tramo de polialanina del exón 3. Casi todos los NPARM identificados hasta ahora se encuentran en el extremo 3 'del exón 2 o en el exón 3. Estos datos representan toda la literatura publicada y los datos actuales proporcionados por los autores de la Declaración (41). Reproducido con permiso de la Referencia 41.

La mayoría de los NPARM ocurren de novo y producen fenotipos muy graves con HSCR y afectación intestinal extensa, necesidad de soporte ventilatorio continuo y aumento del riesgo de tumor en los mayores de 1 año (6, 7). Por tanto, la presencia de HSCR extensa y un fenotipo de CCHS es un fuerte predictor de una PHOX2B NPARM. Las deleciones recurrentes de 38 y 35 pares de bases, que provocan un desplazamiento del marco de la repetición de polialanina en toda la proteína, producen una enfermedad grave y han sido identificadas por varios grupos en diferentes países. Una minoría de NPARM se asocia con una alta incidencia de HSCR pero un fenotipo fisiológico de CCHS más leve y penetrancia incompleta en al menos 3 familias (7). Se han heredado unas pocas mutaciones de desplazamiento de marco ubicadas de manera similar (618delC, 577delG) y tienen una penetración variable en las familias (5, 7), lo que sugiere que los cambios de marco de lectura -1 en esta área pueden producir un déficit celular más leve que otras mutaciones de desplazamiento de marco de lectura. Las mutaciones c.422G & gt A y c.428A & gt G, que conducen a p.R141Q y p.Q143R, respectivamente, también se han encontrado en varios casos no relacionados de CCHS y, junto con c.299G & gt T (p.R100L ) (20), son las únicas mutaciones sin sentido identificadas en CCHS. El c.419C & gt A (p.A140E) se ha informado recientemente en CCHS de inicio tardío, tanto aislado como asociado con HSCR (13, 81).

A pesar de la identificación que PHOX2B es el gen que define la enfermedad para CCHS en 2003, las revistas continúan publicando investigaciones sin (1) confirmación de que todos los sujetos con "CCHS" tienen PHOX2B mutaciones, (2) una distinción en el análisis de datos entre sujetos con PHOX2B CCHS confirmada por mutación y niños con otras causas de hipoventilación, y (3) análisis de datos en un PHOX2B formato genotipo / fenotipo CCHS. Debido al papel crucial de PHOX2B en el desarrollo de la ANS, es pertinente plantear la hipótesis de una relación entre PHOX2B genotipo y los siguientes aspectos del fenotipo CCHS.

Existe una relación entre el genotipo de las PARM y la necesidad de dependencia ventilatoria continua (3, 5, 7, 65). Específicamente, los individuos con el genotipo 20/25 rara vez requieren soporte ventilatorio las 24 horas del día. soporte ventilatorio. Los casos de aparición tardía con el genotipo 20/24 o 20/25 (10, 11, 17) tienen la hipoventilación más leve, que se presenta principalmente después de la exposición a depresores respiratorios o una infección respiratoria grave, y se tratan únicamente con soporte ventilatorio nocturno. A diferencia de los PARM, la mayoría de los individuos con NPARM requieren soporte ventilatorio continuo (7) (Figura 3).

Figura 3. Tasa de dependencia ventilatoria continua, enfermedad de Hirschsprung y tumores de la cresta neural en casos de síndrome de hipoventilación central congénita (CCHS) con mutaciones de expansión repetida de polialanina (PARM) en PHOX2B en comparación con los casos de CCHS con mutaciones de expansión repetida sin polialanina (NPARM) en PHOX2B. Los casos de CCHS incluidos en esta figura se compilaron a partir de todos los casos conocidos reportados en la literatura, incluidos los informes de grupos en los Estados Unidos, Italia, Francia, Japón, Alemania, Taiwán, China, Australia y los Países Bajos, así como la información actual reportada por los autores de la Declaración, cuando se dispuso de información clínica adecuada. Los datos del tumor de la cresta neural se derivaron de casos en los que se disponía de información y el niño había sobrevivido al menos el primer año de vida. Todos los casos de PARM con tumores tenían mutaciones de expansión grandes (29 a 33 repeticiones). Adaptado con permiso de la Referencia 41.

Reconocido desde hace mucho tiempo que ocurre entre el 20% de los casos de CCHS, HSCR es más claramente prevalente entre los casos de NPARM que de PARM. Específicamente, HSCR se informa en 87 a 100% de NPARM en contraste con 13 a 20% de PARM (6, 7, 65) (ver Figura 3 para un histograma de todos los datos publicados adecuadamente detallados, así como todos los datos actuales proporcionados por los autores de la Declaración ATS). Entre los PARM, no hay informes de HSCR que ocurran en sujetos con el genotipo 20/25, y solo en raras ocasiones con el genotipo 20/26. Se informó una alta incidencia de HSCR en individuos con el genotipo 20/27 en una cohorte (6), pero aún no se confirmó definitivamente en otras. Estudios recientes sugieren además que el RETIRADO El gen puede tener un papel fundamental como gen modificador del fenotipo HSCR en pacientes con CCHS (53, 82).

Los tumores de origen de la cresta neural ocurren con más frecuencia entre los individuos con NPARM (50%) que entre aquellos con PARM (1%) (6, 7, 65) (Figura 3) (todos los neuroblastomas). Sin embargo, entre los PARM, hasta ahora solo se ha identificado que los sujetos con los genotipos 20/29 y 20/33 (2, 3, 6, 7) tienen tumores de origen en la cresta neural (ganglioneuromas y ganglioneuroblastomas).

Un informe reciente de Gronli y colegas (9) identificó una correlación entre los PARM más comunes (genotipos 20 / 25-20 / 27) y la duración de los intervalos R-R en el monitoreo Holter. Específicamente, ninguno de los niños con el genotipo 20/25 tuvo pausas sinusales de 3 segundos o más. Sin embargo, el 19% de los individuos con el genotipo 20/26 y el 83% de los individuos con el genotipo 20/27 tuvieron pausas de 3 segundos o más. De manera similar, se implantaron marcapasos cardíacos entre el 0% de los sujetos con el genotipo 20/25, el 25% de los sujetos con el genotipo 20/26 y el 67% de los sujetos con el genotipo 20/27. Entre los casos con los genotipos 20/26 y 20/27 que no recibieron un marcapasos cardíaco, dos murieron repentinamente y uno tuvo un compromiso neurocognitivo severo. Además, un adulto con el genotipo 20/25, diagnosticado con CCHS en la edad adulta, tenía pausas documentadas de 8 segundos y más (11) y los autores de la Declaración ATS han sido alertados sobre otro adulto de inicio tardío con el genotipo 20/25 y prolongado asistolia en grabación Holter. Estos hallazgos plantean la preocupación de que las personas con el genotipo 20/25 pueden no verse afectadas durante la infancia, pero, si no se manejan adecuadamente o no se diagnostican con prontitud, pueden experimentar asistolia prolongada en la edad adulta. El riesgo para las personas con NPARM sigue sin estar determinado.

Weese-Mayer y colaboradores y Patwari y colaboradores (3, 83) demostraron que un mayor número de repeticiones de polialanina se asoció con un mayor número de síntomas de desregulación del SNA (Figura 4). Aunque estas medidas de ANSD se determinaron a partir de la revisión de registros médicos, cuestionarios con guión y evaluación fisiológica, no incluyeron pruebas específicas para evaluar la función autónoma. Sin embargo, los médicos y los padres deben esperar más síntomas de ANSD entre sujetos con genotipos 20/27 a 20/33.

Figura 4. Número de síntomas de desregulación del sistema nervioso autónomo (ANSD) en casos de síndrome de hipoventilación central congénita (CCHS) versus PHOX2B genotipo entre 65 niños con una mutación de expansión repetida de polialanina (PARM). El número de síntomas de ANSD aumenta con el número de alaninas en el PARM. Muchos sujetos tenían números idénticos para los síntomas y el genotipo de ANSD, por lo tanto, la figura da la ilusión de tener menos puntos de datos de los esperados para el tamaño de la cohorte. El análisis del genotipo medido (que consiste en comparar las medias genotípicas mediante ANOVA) reveló una asociación significativa entre PHOX2B longitud de la mutación de repetición de polialanina y número de síntomas de desregulación del SNA (F = 2,93, gl = 5, PAG = 0,021). Adaptado con permiso de la Referencia 3.

Un informe de Todd y sus colegas (8) describió una facies característica entre los niños entre las edades de 2 años y la edad adulta temprana que tienen CCHS y principalmente entre los individuos con PARM. Los rostros de los sujetos con CCHS eran generalmente más cortos y planos, y típicamente mostraban una inflexión inferior del 1/3 lateral del borde bermellón superior (rasgo labial). Aunque no es dismórfica, la cara es corta en relación con su ancho, lo que da como resultado la característica cara en forma de caja que se observa en CCHS. El ochenta y seis por ciento de los casos de CCHS y el 82% de los controles se predijeron correctamente utilizando cinco variables para caracterizar las facies (altura del labio superior, ancho biocular, altura facial superior, protuberancia de la punta nasal y rasgo del labio). Un número limitado de casos con un mayor número de repeticiones (sólo cinco casos con 30-33 repeticiones) puede haber impedido la identificación de una correlación significativa entre el número de repeticiones de polialanina y las medidas del fenotipo facial CCHS.

Todd y sus colegas (84) evaluaron la frecuencia del tipo de patrón dermatoglífico, la simetría izquierda / derecha y la correlación genotipo / fenotipo en CCHS. Las frecuencias del tipo de patrón dermatoglífico se alteraron en los casos de CCHS frente a los controles: se informó aumento de arcos en mujeres y asas cubitales en hombres, con las mayores diferencias para la mano izquierda y para individuos con CCHS y HSCR. Las puntuaciones de disimilitud entre los casos de CCHS y CCHS / HSCR, y entre todos los casos de mujeres y todos los hombres, no fueron significativamente diferentes. No se encontró asociación significativa entre el número de repeticiones de polialanina en el PHOX2B Categorías genotípicas y frecuencias de patrones dermatoglíficos en los grupos de estudio de CCHS.

El término "congénito", tal como se ha utilizado históricamente en CCHS, connotaba la presentación en el período neonatal. Sin embargo, los pacientes que se presentan fuera del período neonatal con CHS de inicio tardío (LO) -CCHS se han descrito previamente (5, 6, 10-17, 24-26, 85). En el contexto de (1) mayor conciencia de CCHS (2) el descubrimiento de que PHOX2B es el gen que define la enfermedad para CCHS y 3) la disponibilidad de pruebas de diagnóstico clínico para PHOX2B mutaciones, se anticipa un aumento en el diagnóstico de LO-CCHS con presentación en la infancia tardía, la niñez y la edad adulta.

LO-CCHS refleja la penetrancia variable del PHOX2B mutaciones con los genotipos 20/24 y 20/25 o raramente un NPARM que puede requerir un cofactor ambiental para provocar el fenotipo. Una revisión cuidadosa de la historia clínica de las personas que “presentan” hipoventilación alveolar después del período neonatal a menudo demuestra signos y síntomas compatibles con hipoventilación previa y otros trastornos de la regulación autonómica del período neonatal. El diagnóstico de LO-CCHS debe considerarse en casos de hipoventilación alveolar mediada centralmente y / o cianosis o convulsiones observadas después de (1) administración de anestésicos o depresores del SNC, (2) infección pulmonar grave reciente, o (3) tratamiento de la apnea obstructiva del sueño. Con una sospecha clínica elevada de LO – CCHS, el médico puede acelerar el diagnóstico mediante la prueba inmediata de una PHOX2B mutación, evitando así una descompensación potencialmente mortal, así como el riesgo de compromiso neurocognitivo. La evaluación de los casos de presentación tardía requiere un historial cuidadoso con atención a la exposición pasada a la anestesia o sedación, la "recuperación" tardía de una enfermedad respiratoria grave y convulsiones inexplicables o deterioro neurocognitivo. Además, revisión de fotografías digitales frontales y laterales (para evaluar facies compatible con CCHS, los hombres adultos a menudo tienen bigote para ocultar el "rasgo labial"), cualquier documentación electrocardiográfica de pausas sinusales prolongadas (idealmente mediante monitoreo Holter de 72 h), cualquier evaluaciones fisiológicas que documenten la ventilación mientras está despierto y dormido (para hipercapnia y / o hipoxemia), un recuento de hematocrito y reticulocitos (para policitemia y respuesta a hipoxemia), un nivel de bicarbonato (para signos de acidosis respiratoria compensada) o radiografía de tórax, Debe completarse un ecocardiograma o electrocardiograma (para detectar signos de agrandamiento de la cavidad derecha o hipertensión pulmonar). En casos de estreñimiento, se puede considerar un enema de bario o una manometría para excluir HSCR de segmento corto. Los pacientes diagnosticados después del período neonatal se denominarían LO-CCHS y se pueden distinguir de otros síndromes de hipoventilación alveolar leve por la presencia de una PHOX2B mutación.

Es probable que el genotipo 20/24 esté infradiagnosticado debido a la hipoventilación sutil y la posible necesidad de cofactores ambientales (17) o la condición homocigótica para manifestar el fenotipo CCHS (66). Análisis moleculares de PHOX2B en cohortes de individuos que presentan hipoventilación profunda después de la anestesia, sedación o enfermedad respiratoria pueden identificar pacientes adicionales con el genotipo 20/24 y 20/25. Al hacerlo, se pueden determinar otros factores ambientales o genéticos aún no identificados que podrían afectar la penetrancia variable de las mutaciones 20/24 y 20/25, así como la nueva mutación sin sentido descrita más recientemente (81).

Es esencial que los médicos distingan LO-CCHS de la obesidad de inicio rápido con disfunción hipotalámica, hipoventilación y desregulación autonómica (ROHHAD) (86), un trastorno poco común descrito por primera vez en 1965 (87). Originalmente denominado síndrome de hipoventilación central de inicio tardío con disfunción hipotalámica (88), se le cambió el nombre en 2007 (86) para alertar al médico sobre la secuencia típica de síntomas de presentación. En esa misma publicación, Ize-Ludlow y sus colegas aclararon que ROHHAD es un síndrome claramente diferente del CCHS, como lo demuestran los cuidadosos antecedentes y PHOX2B pruebas. Aunque en la literatura se han descrito menos de 55 niños con este trastorno (86, 88, 89), es fundamental reconocer el fenotipo como distinto del CCHS. Los niños con ROHHAD típicamente presentan entre 1,5 y 7 años de edad con obesidad de inicio rápido (aumento de 20 a 40 libras en 4 a 6 meses), seguido del reconocimiento de otros trastornos hipotalámicos como desequilibrio hídrico, niveles elevados de prolactina, inicio alterado de la pubertad , y más. Casi la mitad de los niños experimentarán un paro cardiorrespiratorio después de una infección viral intercurrente, luego se notará apnea obstructiva del sueño e hipoventilación. A partir de entonces, en momentos variables, se harán evidentes síntomas de desregulación autonómica que incluyen temperatura corporal baja, manos y pies fríos, bradicardia severa, disminución de la percepción del dolor, entre otros. En cualquier momento de la manifestación de la enfermedad, hasta el 40% de los niños presentará un tumor de origen en la cresta neural, a menudo asociado con escoliosis. Los trastornos del comportamiento, el estrabismo y las respuestas pupilares anormales se informan en ROHHAD. Estos niños a menudo pueden recibir apoyo con ventilación con mascarilla solo por la noche, pero un subconjunto de ellos requerirá ventilación las 24 horas del día a través de una traqueotomía. Aunque se están realizando estudios en curso sobre las posibles causas de ROHHAD, no se ha identificado la causa específica de este trastorno. Como no hay pruebas genéticas disponibles para este trastorno, el diagnóstico de ROHHAD se basa en la presentación clínica, las características clínicas relacionadas y la ausencia documentada de otros diagnósticos potencialmente confusos, incluido el descarte de CCHS con disponibilidad clínica PHOX2B pruebas (documentando la ausencia de PARM y NPARM).

La mayoría de las mutaciones de expansión ocurren de novo en CCHS, pero del 5 al 10% se heredan de un mosaico que normalmente no se ve afectado. Es necesaria una distinción entre la herencia de la línea germinal y la aparición somática de la PHOX2B mutación. Se ha demostrado una penetrancia incompleta cuando se PHOX2B Las mutaciones están presentes en todas las células (incluidas las células reproductoras de la línea germinal) de los individuos que se sabe que no están afectados. Estos últimos PHOX2B Las mutaciones (20/24, 20/25 y algunos NPARM), aunque asintomáticas en algunos individuos, pueden caracterizarse por efectos fenotípicos más leves o variables en los niños afectados con CCHS u otros miembros de la familia (3, 5, 17), respectivamente. . Por el contrario, el mosaicismo somático, debido a mutaciones poszigóticas, se ha informado entre un subconjunto de padres de casos típicos de CCHS que portan PHOX2B alelos de polialanina (PA) mayores de 25 repeticiones y NPARM (3, 6, 7, 16).

El mosaicismo somático para un PARM fue informado por primera vez en 2003 por Weese-Mayer y colegas (3) en 4 padres de 54 familias disponibles (7,4%). En 2005, Trochet y sus colegas (6) identificaron mosaicismo somático en uno de los padres de cada uno de los 10 pacientes con CCHS, lo que confirma que aproximadamente el 10% de los niños con CCHS heredarán la mutación de un padre mosaico. En ambos estudios, se detectó mosaicismo en el ADN extraído de los leucocitos periféricos de los padres al observar una señal más ligera del alelo expandido que del alelo normal, en contraste con el patrón observado en sujetos con CCHS.

Recientemente, en otros dos estudios se evaluó una estimación cuantitativa del mosaicismo somático en padres no afectados. Los productos de amplificación de ADN de portadores asintomáticos de expansiones de alanina con genotipos que van desde 20/25 a 20/31 se cargaron en un secuenciador automático de ADN y se expandieron, y los alelos normales se visualizaron (Figura 5) como picos de salida cuya área subyacente era directamente proporcional a su importes respectivos. Aunque se esperaba que el pico mutante representara el 50% del PHOX2B alelos en individuos que heredaron la mutación, se encontró que variaba del 9 al 35% en el ADN de los leucocitos parentales, este porcentaje se confirmó en estudios de ADN de fibroblastos y saliva de un subconjunto de estos padres mosaico (13). Asimismo, en otro estudio, los individuos mosaico se identificaron como "valores atípicos", con menos señal en el pico correspondiente al alelo expandido (16). Mientras que en estos estudios se demostró mosaicismo somático para PARMs mayores de 20/25, ninguno de los raros portadores aparentemente asintomáticos 20/25 resultó ser mosaico, lo que confirma que en estos casos la falta del fenotipo de la enfermedad se puede atribuir a una penetrancia reducida de un mutación de la línea germinal (13, 16). En conjunto, estos datos apoyan la hipótesis de que los PARM de la línea germinal mayores que el genotipo 20/25 son completamente penetrantes, y los portadores asintomáticos solo pueden encontrarse en asociación con grados significativos de mosaicismo somático.El fenotipo de CCHS no se ha asociado con ningún grado de mosaicismo somático hasta el momento, lo que sugiere un origen de línea germinal para la mayoría de las PARM en pacientes con CCHS afectados.

Figura 5. Cantidades diferenciales de tipo salvaje y expandido PHOX2B alelos en portadores de la mutación PA. Azul los picos representan el PHOX2B alelos portados por un paciente con síndrome de hipoventilación central congénita (CCHS) (superior) y un padre asintomático (fondo). Aunque las posiciones en el eje x corresponden a sus longitudes, como se indica a continuación, la altura del pico es directamente proporcional a su cantidad. En este sentido, el siguiente individuo presenta un mosaicismo somático para el alelo 26 Ala (genotipo 20/26), que de hecho corresponde a mucho menos de la mitad con respecto al alelo 20 Ala de tipo salvaje (genotipo normal 20/20).

Detección de lo mismo PHOX2B La mutación en parejas de padres e hijos y la observación de mosaicismo somático en algunos padres no afectados por la mutación observada en su hijo afectado estableció claramente un patrón de herencia autosómico dominante para CCHS (3, 6). La mayoría de los padres de niños afectados con CCHS no tienen ninguna mutación, lo que indica una alta de novo tasa de mutación en los individuos afectados. Los PARM de genotipo 20/24 y 20/25 y algunos de los NPARM pueden encontrarse en la línea germinal de padres asintomáticos de niños con CCHS e incluso en otros miembros de la familia, lo que sugiere que estas mutaciones se heredan como dominantes con penetrancia incompleta (5, 7, 10). , 11, 13, 17, 26). Los miembros de la familia que portan tales mutaciones pero no tienen CCHS pueden mostrar otros fenotipos de ANSD, incluyendo HSCR o neuroblastoma (7, 48), o pueden ser presintomáticos, presentándose en la niñez tardía o en la edad adulta.

La asesoría genética es crucial para las personas diagnosticadas con CCHS, sus padres y, en algunos casos, miembros específicos de la familia. Para todos los individuos afectados con CCHS, existe un 50% de probabilidad de transmitir la mutación, y por lo tanto el fenotipo de la enfermedad, a cada descendencia. Si se encuentra que un padre no afectado es mosaico para un PHOX2B mutación (generalmente identificada debido a un niño afectado), habrá hasta un 50% de probabilidad de recurrencia en cualquier niño posterior. Siempre se puede suponer que los individuos mosaicos tienen una nueva mutación (la mutación no se puede heredar en forma de mosaico) y, por lo tanto, solo los hijos de estos individuos (no otros miembros de la familia) estarían en riesgo de tener la mutación. Si los padres no afectados son portadores de una mutación de la línea germinal (es decir, un PARM de genotipo 20/25), puede haber muchos otros miembros de la familia que puedan portar la misma mutación sin tener síntomas obvios. En este caso, las pruebas genéticas están indicadas para todas las personas en posición en el pedigrí para heredar la mutación, que a menudo se puede rastrear hasta que se identifica al individuo en el que se originó la mutación. Para evaluar el riesgo de recurrencia en una familia, ambos padres de niños con CCHS deben tener la PHOX2B Prueba de detección realizada para descartar mosaicismo (90) (PARM de genotipos 20/26 a 20/33 y NPARM grave) o un estado de portador no penetrante (PARM de genotipos 20/24 y 20/25 y NPARM leve). Las pruebas prenatales están disponibles y pueden realizarse para personas con o sin CCHS que sean portadores de mutaciones de la línea germinal o que se reconozcan como mosaicos somáticos. A pesar de las pruebas negativas de los padres de un niño con CCHS, no se puede descartar el mosaicismo de la línea germinal y se deben considerar las pruebas prenatales para embarazos posteriores. Las pruebas prenatales pueden brindar a los padres información óptima con la que tomar una decisión informada con una variedad de posibilidades, desde un aborto electivo hasta una sala de partos completamente preparada para optimizar las posibilidades del bebé de una transición sin problemas a la vida extrauterina.

Los tractos de polialanina, predichos en aproximadamente 500 proteínas humanas, se encuentran preferentemente en factores de transcripción y se consideran elementos espaciadores flexibles esenciales para la conformación, las interacciones proteína-proteína y / o la unión al ADN. PA tractos codificados por genes humanos, distintos de PHOX2B, ya se han encontrado expandidos en asociación con al menos nueve trastornos congénitos diferentes, incluido el retraso mental y las malformaciones del cerebro, los dedos y las estructuras de la línea media (91). En este sentido, las expansiones de PA son miembros de una categoría más amplia de trastornos asociados a la repetición de trinucleótidos que incluye también expansiones de poliglutamina (PQ). A diferencia de los tractos PQ, los tramos PA son generalmente estables (no cambian de tamaño cuando se transmiten de una generación a otra), generalmente están codificados por repeticiones imperfectas de trinucleótidos (la alanina puede estar codificada por cuatro tripletes de ADN diferentes) y, con la excepción de contracciones raras , no están presentes como tractos polimórficos en la población humana (la mayoría de los genes de tipo salvaje tienen todos el mismo número de alaninas). Estas observaciones han sugerido una recombinación homóloga alélica desigual (cruzamiento) durante la meiosis y / o la mitosis como el mecanismo causante de enfermedad más atractivo para las expansiones del tracto poli-A (91).

Sin embargo, en individuos mosaico, solo se han informado dos alelos (alelos de tipo salvaje y expandidos), en lugar de los tres alelos (de tipo salvaje, contraído y expandido) que se esperan después de la ocurrencia de un evento somático de entrecruzamiento desigual, demostrando que se debe considerar un mecanismo mutacional alternativo para explicar el origen de estas expansiones de repetición de trinucleótidos (16, 92). De hecho, al razonar que las secuencias de repetición de trinucleótidos imperfectas, típicas de los tractos de PA, reducirían la capacidad de las repeticiones para formar estructuras desalineadas, se ha propuesto el deslizamiento de la replicación como un mecanismo más plausible que el cruzamiento desigual para la generación de expansiones de PA (93). .

Este punto de vista ha sido revisado recientemente después de observar cuatro familias informativas para PHOX2B marcadores cuya segregación fue compatible con la ocurrencia de intercambio desigual de cromátidas hermanas. Es probable que de novo La expansión de las repeticiones de PA en CCHS resulta principalmente de este tipo de evento cromosómico durante la gametogénesis o en células somáticas poszigóticas (94).

Se ha informado de un origen paterno de los gametos que transmiten expansiones en seis informativos de novo Tríos CCHS (94), mientras que en una cohorte más grande de 20 tríos, se produjeron 13 mutaciones en los cromosomas paternos y 7 en los maternos. Por lo tanto, la aparición de expansiones repetidas de AP puede ser independiente de los procesos específicos del desarrollo de los espermatozoides u ovocitos, o puede ser que exista un sesgo de género débil que requeriría el análisis de una muestra más grande de tríos de padres e hijos.

Como factor de transcripción específico de tejido, PHOX2B es responsable de la regulación de la expresión de una serie de genes diana implicados en el desarrollo del SNA. El hallazgo de que PHOX2B se une directamente a las regiones reguladoras de la dopamina-β-hidroxilasa (DβH), PHOX2A, y TLX-2 genes ha permitido la aplicación de un enfoque funcional para revelar los mecanismos moleculares subyacentes a la patogénesis de CCHS. Para tal fin, PHOX2B Se han probado mutaciones para determinar la posible alteración de la función normal de la proteína con respecto a (I) transactivación de diferentes promotores diana, (ii) Unión al ADN, (iii) formación de agregados, y (iv) localización subcelular. Distintos mecanismos patogénicos de CCHS para PARM y NPARM en PHOX2B así han sido postulados. Además, la respuesta celular a PHOX2B Se han investigado las expansiones de polialanina para determinar si existen mecanismos celulares que podrían apuntar para limitar la citotoxicidad de estas mutaciones.

Para investigar como PHOX2B Las expansiones de PA pueden inducir la patogénesis de CCHS, la capacidad de las construcciones de expresión que contienen mutaciones de PA para regular la transcripción de genes diana conocidos se ha comparado, en dos laboratorios diferentes, con un tipo salvaje PHOX2B construir. En particular, como se ejemplifica en la Figura 6A para el gen diana DβH, cuando el mutante PHOX2B Las construcciones se cotransfectaron con DβH y PHOX2A Regiones reguladoras conectadas a la Luciferasa gen, se identificó una estricta correlación inversa entre la actividad luciferasa inducida y la longitud del tracto PA. Esto sugirió que la regulación transcripcional de estos dos genes depende directamente de la estructura correcta del dominio PHOX2B, incluido el tracto de 20-alanina y que los tractos más largos interrumpen cada vez más la transcripción (6, 18). Finalmente, también se ha observado una reducción significativa de la actividad transactivante de las construcciones PHOX2B que llevan diferentes contracciones de PA en el promotor DβH en el mismo ensayo indicador (72). Desafortunadamente, esta observación no se pudo replicar en otro receptor celular (6), lo que sugiere la necesidad de una investigación adicional antes de evaluar si, a pesar de la falta de cualquier efecto fenotípico, las contracciones de AP resultan en alguna interrupción de PHOX2B función.

Figura 6. Efecto de PHOX2B mutaciones en la transactivación del DβH región reguladora. La actividad transcripcional obtenida al cotransfectar el PHOX2B construcciones de expresión informadas a la izquierda de cada diagrama con una construcción que contiene el DβH promotor clonado aguas arriba del Luciferasa El gen reportero se muestra para ambos (A) tractos expandidos de poli-Ala y (B) mutaciones de desplazamiento de marco en términos de actividad relativa de luciferasa. Adaptado con permiso de la Referencia 18.

La microscopía de fluorescencia de células COS-7 que expresan proteínas PHOX2B fusionadas a una molécula verde fluorescente ha demostrado que la proteína PHOX2B de tipo salvaje está presente casi exclusivamente en el núcleo. Sin embargo, el aumento de la longitud de la repetición PA induce a un porcentaje creciente de proteína PHOX2B dentro de las células a localizarse incorrectamente en el citoplasma (Figura 7) (18). Como tal, experimentos similares realizados en células HeLa indujeron la formación de agregados de polialanina PHOX2B, aunque en cantidades diferentes en comparación con las observadas en las células COS-7 (6), lo que sugiere que la localización errónea de la proteína mutante es un mecanismo patogénico común que conduce a una actividad transcripcional alterada. de PHOX2B mutante que contiene tractos PA expandidos propensos a la agregación.

Figura 7. Localización subcelular de proteínas con diferentes defectos de PHOX2B. En los paneles de la derecha, se informan tres posibles patrones de localización celular PHOX2B: (norte) localización nuclear solamente (norte+C) localización tanto nuclear como citoplasmática, ya sea difusa o con formación de agregados nucleares y / o citoplasmáticos y (C) localización citoplásmica únicamente. La distribución subcelular de las proteínas PHOX2B-GFP, después de la transfección celular con construcciones mutantes que llevan diferentes mutaciones de PHOX2B, se informa en los histogramas de la izquierda: 25Ala, 29Ala, 33Ala (encima) y c.930insG, c.614–618delC (debajo). Adaptado con permiso de la Referencia 18.

Además, según los ensayos de cambio de movilidad electroforética, se ha observado que las expansiones que contienen 29 alaninas y más afectan la unión al ADN de PHOX2B, probablemente porque las proteínas mutantes de PHOX2B agregadas no están disponibles para la unión al ADN, confirmó una observación. in vitro mostrando que las proteínas PHOX2B expandidas con PA forman oligómeros espontáneamente (6). Finalmente, la interacción entre la proteína PHOX2B de tipo salvaje con el mutante de 33 repeticiones mal plegadas ha sugerido que las mutaciones de PA también pueden evitar que la proteína normal de su función habitual debido a la agregación anormal con el mutante (6, 18).

En el intento de evaluar el destino de las células que expresan PA expandido PHOX2B, in vitro Los experimentos han demostrado que la activación de la respuesta al choque térmico por el fármaco geldanamicina, un antibiótico natural, es eficaz tanto para prevenir la formación como para inducir el aclaramiento de los agregados de PA preformados de PHOX2B y, en última instancia, también para rescatar la capacidad de PHOX2B para transactivar la Promotor DβH. Además, se ha demostrado la eliminación de proteínas mutantes PHOX2B por el proteasoma y la autofagia, dos mecanismos celulares que ya se sabe que están involucrados en el aclaramiento de proteínas que contienen poliglutamina expandida y tractos de polialanina. La apoptosis celular se ha observado solo en asociación con las mayores expansiones de AP (19).

Las proteínas PHOX2B mutantes no PA probadas hasta ahora han mostrado una activación transcripcional comprometida de los promotores DβH y TLX2 con una alteración de la actividad más grave correlacionada con la longitud de la secuencia C-terminal con desplazamiento del marco de lectura (ver Figura 6B para el efecto sobre la diana DβH) (6, 18, 95). Inesperadamente, PHOX2B Las mutaciones de cambio de marco han mostrado un aumento del 10 al 30% en la activación del PHOX2A región reguladora (18). Además, los cambios de marco y las mutaciones sin sentido han mostrado principalmente una pérdida completa de la unión al ADN pero, a diferencia de las expansiones largas de PA, pueden localizarse correctamente en el núcleo (Figura 7) (6, 18).

Las regiones C-terminales aberrantes pueden causar disfunción de la proteína PHOX2B debido a la falta de capacidad para establecer interacciones proteína-proteína correctas con socios moleculares o al aumento de la capacidad de interactuar con moléculas incorrectas, una hipótesis muy atractiva a la luz de la asociación de mutaciones NPARM con riesgo de desarrollo de neuroblastoma (96). De manera consistente, un estudio reciente ha demostrado que el mutante no PA PHOX2B Los constructos retuvieron la capacidad de suprimir la proliferación celular sin poder promover la diferenciación (20), lo que sugiere un mecanismo que podría promover el desarrollo de tumores de la cresta neural.

En conclusión, estos estudios han indicado una marcada diferencia entre los PARM y los NPARM con desplazamiento de marco en términos de transactivación de los promotores diana, formación de agregados y localización subcelular. Futuro in vitro La investigación proporcionará más pistas sobre la patogenia y posibles pistas terapéuticas.

Antes del descubrimiento de 2003 que PHOX2B es el gen que define la enfermedad para CCHS, el espectro clínico de gravedad en términos de hipoventilación y otros aspectos del fenotipo ANSD han desconcertado a los médicos durante mucho tiempo. Una vez que se considera el diagnóstico de CCHS, se debe enviar sangre para PHOX2B Prueba de pantalla (ver Figura 8 ). En caso de que la prueba de detección sea negativa y el fenotipo del paciente respalde el diagnóstico de CCHS o LO – CCHS o el médico / familia quiera descartar por completo el diagnóstico de CCHS, entonces la secuela PHOX2B Se debe realizar la prueba de secuenciación (disponible en Children's Memorial Hospital, Chicago, IL, para opciones adicionales, consulte www.genetests.org). Esta prueba de dos pasos es más rentable (la mutación en el 95% de los casos de CCHS se identificará con el económico PHOX2B Prueba de detección y solo un subconjunto de los NPARM requerirán la PHOX2B Prueba de secuenciación a identificar). A la espera de los resultados de las pruebas disponibles clínicamente PHOX2B Las pruebas (alta sensibilidad y especificidad) deben descartarse otras causas de hipoventilación para acelerar la intervención adecuada y facilitar las estrategias de tratamiento para la atención domiciliaria. La enfermedad pulmonar primaria, la debilidad de los músculos ventilatorios y la enfermedad cardíaca deben descartarse con las siguientes pruebas: radiografía de tórax y potencialmente TC de tórax, evaluación neurológica completa y potencialmente biopsia muscular y ecocardiograma, respectivamente. Las lesiones cerebrales / del tronco encefálico macroscópicas causales deben descartarse mediante una resonancia magnética y / o una tomografía computarizada del encéfalo y el tronco encefálico (97, 98). Asimismo, se deben considerar los errores innatos del metabolismo y se debe realizar un cribado metabólico.

Figura 8. Electroforesis en gel de poliacrilamida PHOX2B Prueba de pantalla. Se muestran PHOX2B mutaciones de expansión de repetición de polialanina (PARM) por tamaño de repetición de polialanina y no PARM (NPARM) para el síndrome de hipoventilación central congénita (CCHS) más común que causa PHOX2B genotipos identificados con el PHOX2B Prueba de selección comparada con el producto de tipo salvaje (carriles 3 y 15). Los carriles 1-2 indican resultados para NPARM con deleciones grandes: 722del35 y 722del38. Los carriles 4–14 indican el análisis de varios PARM, incluidos los padres en mosaico (genotipo 20/26 y 20/27), así como probandos (genotipos 20 / 24–20 / 33). Los carriles 7 y 9 son portadores de mosaico de PARM que causan CCHS. El carril 7 es un padre en mosaico del probando identificado en el carril 6. El carril 9 es un padre en mosaico del probando identificado en el carril 8. Tenga en cuenta que la intensidad de la banda del alelo expandido es mucho más clara que la del alelo de tipo salvaje en los carriles 7 y 9. También tenga en cuenta que aunque la intensidad general de la señal en el carril 8 es baja, tanto la banda expandida como la de tipo salvaje son similares en intensidad, lo que indica un portador completo del alelo de 27 repeticiones expandidas. Reproducido con permiso de la Referencia 41.

Independientemente de las anomalías del control respiratorio, los niños con CCHS tienen otra evidencia de desregulación autonómica difusa (27, 28). Para aquellas personas con síntomas de estreñimiento, se debe realizar un enema de bario o manometría y potencialmente una biopsia rectal de espesor total para diagnosticar HSCR (99). Las imágenes seriadas de tórax y abdomen son esenciales entre los niños con NPARM y aquellos niños con el genotipo 20/29 al 20/33 para la aparición de un tumor de la cresta neural, específicamente neuroblastoma (NPARM) y ganglioneuroblastoma / ganglioneuroma (PARM) (100). Debido a que no se han identificado niños con genotipos 20/24 a 20/28 con tumores de origen en la cresta neural, se desconoce el valor de las imágenes en serie en estos casos. Se han descrito anomalías del ritmo cardíaco, incluida la disminución de la variabilidad de la frecuencia cardíaca latido a latido, la reducción de la arritmia sinusal respiratoria y la asistolia abrupta transitoria (9, 101, 102). El monitoreo Holter de setenta y dos horas realizado anualmente puede determinar ritmos cardíacos aberrantes, pausas sinusales que requerirán la implantación de un marcapasos cardíaco bipolar (103) y la frecuencia de pausas más cortas (es decir, menos de 3 s) que pueden tener un impacto fisiológico y neurocognitivo. Los niños con CCHS están en riesgo de hipertensión pulmonar progresiva y cor pulmonale como resultado de hipoxemia recurrente debido a ajustes inadecuados del ventilador o calibre de traqueotomía, hipoventilación no reconocida durante la respiración espontánea mientras están despiertos, ejercicio excesivo con compromiso fisiológico resultante o cumplimiento subóptimo de la ventilación artificial. Como resultado, los ecocardiogramas, los hematocritos y los recuentos de reticulocitos realizados cada 12 meses proporcionarán información sobre el posible cor pulmonale y policitemia, y las pruebas se realizarán con mayor frecuencia si están clínicamente indicadas y justificadas. Los pacientes con CCHS presentan con frecuencia anomalías oftalmológicas que reflejan el papel de PHOX2B sobre los nervios craneales que controlan la función pupilar (23, 29). Las pruebas oftalmológicas integrales determinarán la naturaleza de la participación oftalmológica y permitirán estrategias de intervención para evitar la interferencia con el aprendizaje. Se han descrito informes anecdóticos de mala tolerancia al calor y sudoración profusa (1), pero no se han estudiado de forma exhaustiva. Se ha informado una evaluación formal muy limitada de la ANS, y ninguna ha sido analizada por PHOX2B genotipo.Las pruebas autonómicas integrales indicadas clínicamente para evaluar el síncope y la función del sistema nervioso autónomo pueden incluir pruebas de inclinación, respiración profunda, maniobra de Valsalva, factores de estrés térmico, pupilometría y más, a medida que se desarrollan nuevas medidas de pruebas autonómicas para bebés y niños.

Se ha observado un rendimiento escolar subóptimo y / o una función intelectual disminuida en pacientes con CCHS (23, 104-107). No está claro si esto se debe a hipoxemia por soporte ventilatorio inadecuado o un resultado directo del problema neurológico primario asociado con CCHS. A medida que los niños con CCHS se identifican de manera más consistente en el período neonatal, y a medida que el manejo de estos niños complejos y vulnerables se vuelve más estandarizado, se anticipa un mejor desempeño neurocognitivo con distinción entre las secuelas de hipoxemia (debido a hipoventilación o asistolia) y la enfermedad innata específica de CCHS . Las pruebas neurocognitivas integrales realizadas anualmente en un entorno controlado evaluarán el progreso del niño en relación con la intervención, el manejo y el cumplimiento y pueden identificar áreas de intervención. Los niños con CCHS tienen un buen futuro y los pacientes de mayor edad identificados neonatalmente se gradúan de la universidad, se casan y mantienen un empleo. Corresponde a la familia y al personal médico proporcionar una oxigenación y ventilación óptimas para asegurar la maximización del potencial neurocognitivo. Es esencial una intervención educativa agresiva junto con un manejo ventilatorio y cardiovascular cuidadoso (23, 104-107).

En la situación ideal, la atención de las personas con CCHS se proporcionaría a través de centros con amplia experiencia en CCHS, trabajando en estrecha colaboración con neumólogos y pediatras pediátricos regionales. Ese arreglo mejorará aún más la consistencia de la gestión e idealmente mejorará el nivel de resultado para las personas con CCHS. Aunque puede haber resistencia a la derivación a dichos centros, los autores de la Declaración ATS señalan que muchos neumólogos pediátricos extremadamente capaces están manejando básicamente a niños con CCHS como lo harían con otros pacientes con traqueotomías y ventiladores. Están viendo a los pacientes a intervalos variables que van de 4 a 12 meses, solo revisan las medidas fisiológicas durante 5 minutos despiertos en la clínica, no toman un historial de medicina autonómica, no revisan la tecnología en el hogar o el acceso a energía y atención de emergencia, no reevaluar el tamaño del tubo de traqueotomía después del período neonatal, no cambiar del tubo del ventilador neonatal al tubo pediátrico, no educar a los padres sobre el manejo del ventilador y la utilidad de la monitorización no invasiva, no recomendar que todos los padres sean examinados con el PHOX2B Prueba de detección para determinar el mosaicismo y más. Esencialmente son practicantes extremadamente capaces pero ocupados que no tienen el tiempo o intensivo experiencia para enfocarse en los matices que son esenciales para el manejo exitoso de los niños con CCHS y sus familias. El objetivo es aceptar que cuidar a niños con CCHS es un privilegio que requiere un cuidado profundo que no es típico de otros pacientes con trastornos pulmonares más comunes. Simplemente no hay tiempo suficiente para que el neumólogo pediátrico (que hace malabarismos con pacientes con fibrosis quística, enfermedad pulmonar crónica, asma y más) brinde una atención profunda a las necesidades de un niño con CCHS. Debido a la naturaleza del PHOX2B mutaciones, y el rango de fenotipo basado en estas mutaciones, la experiencia incluso con 15 a 30 pacientes no comienza a proporcionar el alcance de la experiencia necesaria para comprender las necesidades del niño con CCHS.

La hipoventilación alveolar es el sello distintivo de CCHS y su característica fenotípica más aparente y potencialmente debilitante. De manera característica, la disminución del volumen corriente con el efecto resultante sobre la ventilación minuto es más evidente en el sueño no REM en CCHS, pero también es anormal durante el sueño REM y la vigilia, aunque generalmente en un grado más leve (23, 108, 109). El espectro de trastornos respiratorios del sueño puede variar en severidad desde hipoventilación durante el sueño no REM con ventilación adecuada durante la vigilia, hasta apnea completa durante el sueño e hipoventilación severa durante la vigilia. El fenotipo CCHS relativo a las necesidades ventilatorias es PHOX2B dependiente del genotipo / mutación. Por lo general, los niños con el genotipo 20/27 a 20/33 y los NPARM requerirán 24 horas al día de ventilación mecánica. Los niños con los genotipos 20/24 y 20/25, y un pequeño subconjunto de NPARM, rara vez requieren 24 horas al día de ventilación, a menos que hayan tenido un manejo ventilatorio subóptimo durante períodos prolongados en la primera infancia. Las necesidades de ventilación despiertas de los niños con el fenotipo 20/26 variarán con el nivel de actividad. No está claro si la respiración espontánea mientras está despierto mejorará con la pubertad.

Se desconoce la incidencia de CCHS en la población general, aunque es probable que la incidencia varíe según la etnia según las estadísticas actuales (aproximadamente el 90% de los sujetos identificados son caucásicos en la revisión de informes publicados y en la comunicación personal de los laboratorios de los miembros de la ad hoc Comité de Declaraciones). Con el reconocimiento de que las personas con los genotipos 20/24 y 20/25 tienen expresividad variable y es posible que no se presenten a la atención médica hasta que reciban sedación o tengan una enfermedad pulmonar grave, corresponde a la comunidad médica identificar a dichos pacientes antes de enfrentarse a una vida. -Situación amenazadora. Lo que es evidente es que la incidencia de CCHS ya no es tan rara como se anticipó en el momento de la primera Declaración de ATS sobre CCHS en 1999 (1). La determinación de una incidencia real requerirá un gran estudio poblacional en todos los grupos étnicos.

Los resultados de los informes de respuestas ventilatorias y de excitación despierto y dormido (108, 110-112), concentración mental (34), sensaciones respiratorias (35, 36), respuesta fisiológica al ejercicio y movimiento de las piernas (32-35, 113, 114) , y las anomalías focales en la resonancia magnética funcional (115-118) deben interpretarse con precaución, ya que probablemente reflejen un sesgo debido al pequeño tamaño de la muestra, informando en laPHOX2B era, presentación de datos que incluye sujetos con CCHS y con otras causas de hipoventilación (108), o sin documentación de PHOX2B confirmación de CCHS en todos los sujetos e inclusión casi exclusiva de niños que pudieron mantener una ventilación adecuada durante la vigilia en reposo (por lo que es probable que casi todos los sujetos tuvieran el genotipo 20/25 según el fenotipo y los protocolos descritos). Hasta que los estudios se repitan en grandes cohortes que incluyen una amplia gama de niños y adultos con genotipos 20/24 a 20/33, así como los NPARM, estos resultados pueden representar la fisiología solo de los pacientes más leves con CCHS.

Estudios fisiológicos completos semestrales y luego anuales en el hospital durante los estados despierto y dormido para evaluar las necesidades ventilatorias durante los diferentes niveles de actividad y concentración, en todas las etapas del sueño, con respiración espontánea y con ventilación artificial, y la respuesta ventilatoria a los desafíos fisiológicos endógenos y exógenos despierto y dormido, determinará las necesidades de cada niño para un manejo clínico óptimo. Estos estudios, realizados en el transcurso de una hospitalización de varios días en un centro con amplia experiencia en CCHS, permitirán una clara comprensión de las necesidades tanto en la respiración espontánea como en la ventilación artificial por cualquiera de los medios descritos en los apartados siguientes. Estos estudios fisiológicos deben incluir supervisión constante por personal altamente capacitado y vigilancia audiovisual continua con registro continuo (como mínimo) de pletismografía de inductancia respiratoria (tórax, abdomen, suma), ECG, saturación de hemoglobina, forma de onda de pulso, dióxido de carbono al final de la espiración, estado de sueño. estadificación, presión arterial y temperatura. Otras pruebas recomendadas para personas con PHOX2B La CCHS confirmada por mutación se proporciona en la Tabla 1.

TABLA 1. PRUEBAS RECOMENDADAS PARA CARACTERIZAR EL FENOTIPO DE CCHS

Definición de abreviaturas: PARM = mutación de expansión de repetición de polialanina NPARM = mutación de expansión de repetición de polialanina (sin sentido, sin sentido, desplazamiento de marco).

* Los bebés menores de tres años deben someterse a evaluaciones integrales cada 6 meses.


En los insectos, ¿la repetición de alanina ocurre en la secuencia del homeodominio del abdomen o ocurre en una secuencia diferente? - biología

Comentario: informado como anlage del ectodermo procefálico

Comentario: informado como anlage del ectodermo procefálico

Comentario: informado como anlage del ectodermo procefálico

Comentario: informado como anlage del ectodermo procefálico

Comentario: expresado en el tejido graso femenino que rodea a las espermatozoides

La expresión se examinó en cuatro fases de la etapa embrionaria 5. prd se expresa inicialmente en un patrón similar a un espacio no periódico en la parte anterior, que comienza a resolverse en franjas en la fase 2, sin embargo, el patrón completo de 7 franjas surge solo durante la fase 3. El las franjas emergen completamente refinadas, con franjas nítidas y uniformemente espaciadas.

La expresión de prd está enriquecida en machos adultos.

La transcripción de prd es reprimida por la proteína ectópica eve en embriones eve hs.PS. El tiempo sugiere que eve es un regulador directo de prd.

Las transcripciones de prd se elevan a un pico agudo en embriones de 2-4 horas, disminuyen rápidamente y son indetectables después de 12 horas. Están ausentes en los ovocitos. prd se expresa inicialmente con periodicidad de doble segmento (7 franjas) pero cambia en el blastodermo celular a un patrón de periodicidad de segmento único (14 franjas).

Se observa un transcrito de prd de 3,6 kb además del transcrito de 2,5 kb en ARN embrionario de 0 a 4 horas de madres heterocigotas prd 4.

La proteína prd se expresa en las glándulas accesorias masculinas. Inicialmente se expresa en niveles altos en todas las células de las glándulas accesorias, pero los niveles de proteínas disminuyen con el aumento de la edad de los machos vírgenes. Los niveles de proteína prd disminuyen más rápidamente en las células principales que en las secundarias. En machos de 10 días, la proteína prd se detecta solo en células secundarias dispersas en la región distal de las glándulas. El apareamiento aumenta el nivel de proteína prd

s en las células principales y secundarias de las glándulas.

La proteína prd se detecta por primera vez en la región anterior de embriones muy tempranos y posteriormente se restringe a una franja anterior muy estrecha. Durante la celularización, se observan rayas en forma de campana (rayas 3-7). El orden de aparición de las rayas es 4 y 7, seguido de 3 y 6, y finalmente surge la 5. En este punto, la franja anterior se divide en dos. A mitad de la celularización, la proteína prd ha alcanzado niveles iguales en todas las franjas. Al mismo tiempo, la acumulación preferencial de proteína prd en los márgenes posteriores genera un gradiente dentro de cada franja. Durante la segunda mitad de la celularización, la expresión también ocurre en un parche de células en el extremo dorsal anterior del embrión y en una octava franja. Al final de la gastrulación, el número de rayas se ha duplicado a 14 como resultado de la reducción de proteína en el medio de las rayas acompañada de un aumento de proteína en la región anterior de las rayas. Al final de la etapa de extensión de la banda germinal, la expresión en las rayas ha desaparecido. La proteína prd se expresa en la región de la cabeza, con mayor fuerza en el lóbulo maxilar, pero también en los lóbulos labial y mandibular y en el clipeolabrum. La proteína prd también se detecta en el SNC en desarrollo en 2-3 neuronas específicas por hemisegmento.


Clasificación de proteínas Hox

También se asume generalmente que las proteínas con un alto grado de similitud de secuencia exhiben un alto grado de similitud funcional, es decir, se supone que las proteínas Hox con homeodominios idénticos tienen propiedades de unión al ADN idénticas (a menos que se sepa que secuencias adicionales influyen en la unión al ADN). Para identificar el conjunto de proteínas entre dos especies diferentes que tienen más probabilidades de ser más similares en función, se utilizan esquemas de clasificación. Para las proteínas Hox, existen tres esquemas de clasificación diferentes: basado en inferencia filogenética, basado en sintenia y basado en similitud de secuencia. [20] Los tres esquemas de clasificación proporcionan información contradictoria para las proteínas Hox expresadas en el medio del eje del cuerpo (Hox6-8 y Antp, Ubx y abd-A). Un enfoque combinado utilizó información basada en inferencias filogenéticas de las diferentes especies y trazó los tipos de secuencias de proteínas en el árbol filogenético de las especies. El enfoque identificó las proteínas que mejor representan formas ancestrales (Hox7 y Antp) y las proteínas que representan nuevas versiones derivadas (o se perdieron en un ancestro y ahora faltan en numerosas especies). [21]


En los insectos, ¿la repetición de alanina ocurre en la secuencia del homeodominio del abdomen o ocurre en una secuencia diferente? - biología

Comentario: informado como anlage del ectodermo procefálico

Comentario: informado como anlage del ectodermo procefálico

Comentario: informado como anlage del ectodermo procefálico

Comentario: informado como anlage del ectodermo procefálico

Comentario: expresado en tejido graso femenino que rodea las espermatozoides

La expresión se examinó en cuatro fases de la etapa embrionaria 5. prd se expresa inicialmente en un patrón no periódico similar a un espacio en la parte anterior, que comienza a resolverse en franjas en la fase 2; sin embargo, el patrón completo de 7 franjas surge solo durante la fase 3. El las franjas emergen completamente refinadas, con franjas nítidas y uniformemente espaciadas.

La expresión de prd está enriquecida en machos adultos.

La transcripción de prd es reprimida por la proteína eve ectópica en embriones eve hs.PS. El tiempo sugiere que eve es un regulador directo de prd.

Las transcripciones de prd se elevan a un pico agudo en embriones de 2-4 horas, disminuyen rápidamente y son indetectables después de 12 horas. Están ausentes en los ovocitos. prd se expresa inicialmente con periodicidad de segmento doble (7 franjas) pero cambia en el blastodermo celular a un patrón de periodicidad de segmento único (14 franjas).

Se observa un transcrito de prd de 3,6 kb además del transcrito de 2,5 kb en ARN de embrión de 0 a 4 horas de madres heterocigotas prd 4.

La proteína prd se expresa en las glándulas accesorias masculinas. Inicialmente se expresa en niveles altos en todas las células de las glándulas accesorias, pero los niveles de proteínas disminuyen con el aumento de la edad de los machos vírgenes. Los niveles de proteína prd disminuyen más rápidamente en las células principales que en las secundarias. En machos de 10 días, la proteína prd se detecta solo en células secundarias dispersas en la región distal de las glándulas. El apareamiento aumenta el nivel de proteína prd

s en las células principales y secundarias de las glándulas.

La proteína prd se detecta por primera vez en la región anterior de embriones muy tempranos y posteriormente se restringe a una franja anterior muy estrecha. Durante la celularización, se observan rayas en forma de campana (rayas 3-7). El orden de aparición de las rayas es 4 y 7, seguido de 3 y 6, y finalmente surge la 5. En este punto, la franja anterior se divide en dos. A mitad de la celularización, la proteína prd ha alcanzado niveles iguales en todas las franjas. Al mismo tiempo, la acumulación preferencial de proteína prd en los márgenes posteriores genera un gradiente dentro de cada franja. Durante la segunda mitad de la celularización, la expresión también ocurre en un parche de células en el extremo dorsal anterior del embrión y en una octava franja. Al final de la gastrulación, el número de rayas se ha duplicado a 14 como resultado de la reducción de proteína en el medio de las rayas acompañada de un aumento de proteína en la región anterior de las rayas. Al final de la etapa de extensión de la banda germinal, la expresión en las rayas ha desaparecido. La proteína prd se expresa en la región de la cabeza, con más fuerza en el lóbulo maxilar, pero también en los lóbulos labial y mandibular y en el clipeolabrum. La proteína prd también se detecta en el SNC en desarrollo en 2-3 neuronas específicas por hemisegmento.


Métodos

Insectos y materiales

Anopheles gambiae (cepa PEST) se criaron y mantuvieron en una cámara ambiental a 26 ° C, 85% de humedad relativa, con un ciclo de 16 horas de luz y ocho horas de oscuridad que incluía un período de anochecer / amanecer de una hora [18]. Las larvas se alimentaron diariamente con una mezcla 2: 1 de pellets de pescado: levadura de cerveza, finamente molida [19]. DL-octopamina, tiramina, dopamina, nafazolina, clonidina, serotonina, clorpromazina, ciproheptadina, prometazina, todas las sales de clorhidrato y tolazolina, una sal de bencilimidazolina, se obtuvieron de Sigma-Aldrich. El clorhidrato de metoclopramida se obtuvo de MP Biomedical. Los compuestos identificados en la pantalla virtual se compraron en Princeton BioMedical, ChemDiv, Chembridge y Enamine y se probaron in vitro contra AgOAR45B expresado en GloResponse ™ CRE-luc2P Línea celular indicadora HEK293 y en bioensayos larvarios.

Análisis de expresión de AgOAR45A y AgOAR45B

El ARN total se aisló de cinco Un. Gambiae estadios inmaduros (L1-P), hembras y machos adultos, solo cabezas de hembras adultas y abdomen / tórax de hembras adultas utilizando el Mini Kit RNeasy (Qiagen). El ARN tratado con DNasa (Fermentas) se usó para generar ADNc usando Superscript III (Invitrogen) y oligo (dT12–20), de acuerdo con las recomendaciones del fabricante. La PCR cuantitativa (qPCR) se realizó utilizando SYBRGreen (ABI), un sistema ABI 7900 RT-PCR y 200 ng de ADNc por muestra, una concentración final de 0,15 M de cada cebador y una temperatura de hibridación de 60 ° C. Los conjuntos de cebadores utilizados para el análisis de expresión fueron: Ag10592 directo- CACCATCGAACACAAAGTTGACACTT Ag10592 inverso- CGAACGTAACGTCACGGCCA Ag45A & ampB directo- GGGTACGTCGTCTACTCAGCCCTC Ag45A inverso- TGTATCCGCAGCGTTAGCCGTC45GCGCAGCTTAGCCGTC45. La subunidad 7 de la proteína ribosómica 40S (AGAP01592) se utilizó como control interno. Las reacciones para cada gen y para el control utilizado se llevaron a cabo por triplicado. Los niveles de expresión relativa de cada gen se determinaron mediante el ΔΔCT método, donde la expresión relativa se expresa como una diferencia de veces con respecto a las hembras completas y se expresa como 2 - ΔΔCT. Se utilizó la siguiente fórmula: ΔΔCT = ΔCT (etapa o condición) - ΔCT (mujeres) y ΔCT = CT (gen de interés) - CT (ARN 40S).

Expresión heteróloga del receptor de octopamina AgOAR45B

Se aisló el ARN total de cabezas de hembras adultas de tres días usando RNeasy Mini Kit (Qiagen). El ADNc se sintetizó usando SuperScript III (Invitrogen) y se usó como plantilla para la amplificación por PCR del AgOAR45A y AgOAR45B genes. Inserción de las secuencias de codificación en el SGF yo y Pme Los sitios I del vector pF9a CMV hRluc-neo (Promega) se llevaron a cabo mediante la digestión de un fragmento amplificado por los siguientes cebadores: Ag45forward- TAAAGCGATCGCCATGAACGAGTCGGAGTGTGCC Ag45Areverse- TTGTGTTTAAACTCTCGAGTCGGACAGGCGAGACCAGCGAGTCGGACGCGAGACTACGCGACTCGGACGGACGAGAC. Los cebadores se construyeron basándose en la secuencia anotada del gen AGAP000045 (VectorBase, ID de proteína: AGAP000045-PA y -PB [20]).

GloResponse ™ CRE-luc2P La línea celular indicadora HEK293 (Promega) se mantuvo como cultivo adherente a 37 ° C, 5% de CO2 en DMEM (Invitrogen) suplementado con suero de ternero fetal al 10% (Atlanta) y 50 mg / ml de higromicina B. La transfección de las células se llevó a cabo utilizando el kit Amaxa Nucleofector según las instrucciones del fabricante.Las transfecciones de control se realizaron usando un plásmido pF9A con el gen barnasa (ribonucleasa bacteriana) eliminado como sugiere el fabricante (Promega). Se crearon líneas estables aplicando 400 mg / ml de G418 durante tres semanas. Se crearon clones estables de AgOAR45B que expresaban células indicadoras HEK293 mediante dos rondas de clonación por dilución limitante.

Ensayo de AMPc

El aumento de AMPc intracelular se controló mediante una construcción informadora CRE-luc en células HEK293 (Promega). Las líneas celulares estables se sembraron en placas a una densidad de 4 x 104 células por pocillo en placas de ensayo blancas de 96 pocillos (Corning, Cat. # 3917). Las células se trataron inmediatamente con los diversos compuestos y se devolvieron a la incubadora durante cuatro horas antes de analizarlas. El cAMP se cuantificó mediante la producción de luciferasa utilizando el kit de ensayo de luciferasa Dual-Glo (Promega) siguiendo las instrucciones del fabricante. Las unidades de luciferasa se normalizaron al número de células usando la construcción Rluc interna en el plásmido de expresión pF9A.

Ensayo de Ca ++ intracelular

Líneas celulares estables que expresan AgOAR45A o AgOAR45B se sembraron en placas de ensayo de 96 pocillos de fondo transparente y pocillo negro (Greiner Bio-One, nº de cat. 655090) a 4 x 104 células por pocillo. Se dejó que las células crecieran durante la noche antes de analizarlas. Las células se precargaron con Fluo-4 NW (dispositivos moleculares) y se llevaron a cabo según las instrucciones del fabricante. La fluorescencia se controló antes y después de la adición de compuestos usando Flexstation3 (Molecular Devices), a intervalos de dos segundos durante 120 segundos.

Mutagénesis dirigida al sitio de AgOAR45B

los AgOAR45B El gen se subclonó en un vector TA (Invitrogen), de acuerdo con las instrucciones del fabricante. Mutagénesis dirigida al sitio de AgOAR45B se llevó a cabo con el kit Quick Change Lightning (Agilent). Los cebadores (IDT) se diseñaron para introducir cambios de un solo aminoácido (consulte el archivo adicional 1). Los mutantes dobles se crearon a través de dos rondas de mutagénesis. Las mutaciones se confirmaron mediante secuenciación automatizada (ND Genomics Core Facility). A continuación, se escindieron los genes mutantes y se trasladaron al vector de expresión pF9A como se describió anteriormente.

Preparación de membranas y ensayo de unión de radioligandos

Las células en matraces T75 se lavaron con 10 ml de PBS, se eliminaron raspando, se centrifugaron a 500 gy luego se resuspendieron en 5 ml de tampón de lisis, Tris-Cl 50 mM pH 7,4. Las células se incubaron en hielo durante 10 min y se homogeneizaron con un homogeneizador Dounce con 30 golpes. El homogeneizado y 5 ml de lavado con tampón de lisis se centrifugaron luego a 23.000 g durante 30 min a 4ºC para sedimentar las membranas crudas. El sedimento resultante se resuspendió en Tris-Cl 50 mM pH 7,4, MgCl2 5 mM, EDTA 0,5 mM pH 7,4 y se cuantificó mediante microensayo BCA (Thermo).

Los ensayos de unión de radioligando se llevaron a cabo usando 3 H-yohimbina para determinar la afinidad de unión del receptor de octopamina con diferentes compuestos. Se incubaron membranas aisladas, 30 μg por pocillo, en presencia de 3 H-yohimbina (productos químicos estadounidenses radiomarcados) 16 nM en tampón de unión y diversas concentraciones de compuestos. El volumen de reacción final fue de 125 ml por pocillo en una placa de ensayo de 96 pocillos. Se usó clonidina cien mM para determinar la unión no específica en cada experimento. Después de una incubación de dos horas, se recogieron las membranas y se lavaron sobre esterillas filtrantes, se trataron previamente con polietilenimina al 0,3% (Sigma) usando un recolector Brandel de 96 pocillos y se contaron en un contador Perkin Elmer Microbeta.

Bioensayo de larvas

Se hicieron curvas de respuesta a la dosis para determinar la LD50 para algunos compuestos contra tres días de edad Aedes aegypti larvas. Se colocaron diez larvas en cada pocillo de una placa de 12 pocillos, y cada pocillo contenía una concentración diferente de compuesto en agua. Se hicieron tres pocillos replicados para cada experimento y las curvas se realizaron tres veces por separado. Se incluyeron pozos de control en cada experimento, que contenían solo DMSO en agua. Las placas se incubaron durante 24 horas en condiciones estándar de insectario. La mortalidad se determinó a las 24 horas.

Flujo de trabajo del proyecto

Un flujo de trabajo computacional-experimental (ver archivo adicional 2), similar al enfoque computacional descrito por Yarnitzky et al.[21] se utilizó. El método fue el siguiente: 1) se crearon modelos de homología, tanto inactivos (basados ​​en antagonistas) como activos (basados ​​en agonistas), utilizando el método basado en fragmentos I-TASSER (Refinamiento de ensamblaje de roscado iterativo) [22-24] como así como rodeado de lípidos, agua e iones usando dinámica molecular visual (VMD) [25] 2) una pantalla virtual preliminar con uno de los dos conjuntos de prueba compuestos (compuestos de agonistas o antagonistas de GPCR cuya actividad en AgOAR45B se determinó experimentalmente usando un AgOAR45B reporter ensayo) y se eligió un conjunto de posiciones de la mayoría de las mejores clasificadas y se utilizaron en simulaciones de MD con las conformaciones de proteínas activas (agonista-vinculantes) e inactivas (antagonistas-vinculantes) adecuadas 3) Se realizaron simulaciones MD hasta que se establecieron Se obtuvieron las posiciones de los ligandos, luego se realizó una pantalla virtual adicional con el conjunto de prueba en cada conformación de proteína resultante y los resultados se analizaron manualmente. El paso 3 se repitió hasta que las posiciones de los ligandos se estabilizaron en la proteína incluso después de diez nanosegundos (ns) adicionales de simulación 4) las conformaciones finales se usaron luego para construir cuadrículas que se sometieron a un cribado virtual utilizando la biblioteca ZINC y, 5) los compuestos resultantes Se analizaron y se compraron compuestos con diferentes características estructurales y se probaron experimentalmente. in vitro.

Modelado de homología

Tanto las conformaciones iniciales inactivas (basadas en antagonistas) como activas (basadas en agonistas) de AgOAR45B se generaron utilizando el servidor en línea I-TASSER [26]. Para la conformación inactiva, se obtuvo una estructura que se construyó sobre la base de muchas conformaciones unidas al antagonista GPCR y unidas al agonista inverso, principalmente una estructura cristalina de β2-receptor adrenérgico con agonista inverso parcial unido a carazolol [PDB: 2RH1]. Para la conformación activa se obtuvo una estructura que se construyó a partir de la estructura cristalina de la β2-receptor adrenérgico-Gαs complejo proteico con agonista de alta afinidad BI-167107 unido [PDB: 3SN6]. Ambas conformaciones se obtuvieron utilizando los ajustes estándar de I-TASSER. En el caso de la conformación activa de AgOAR45B, se utilizó 3SN6 (cadena R) como plantilla para generar el modelo. Las desviaciones cuadráticas medias (RMSD), como medida de la estabilidad de las proteínas, se calcularon utilizando la herramienta VMD 1.9 RMSD Trayectoria [25]. AgOAR45B tiene una identidad de secuencia del 24% (35% de similitud) con el β2-receptor adrenérgico (ver archivo adicional 3). Los residuos del sitio activo se determinaron a partir del análisis de la β inactiva y activa.2-Estructuras cristalinas del receptor adrenérgico y la observación de residuos que interactuaron o tenían el potencial de interactuar con los ligandos unidos a las estructuras cristalinas [27, 28]. La identidad de la secuencia del sitio activo es mucho mayor al 67% (similitud del 73%).

Dinámica molecular

Usando VMD 1.9, cada representación virtual de la proteína se incrustó primero en una bicapa lipídica grande de 1-palmitoil-2-oleoilfosfatidilcolina (POPC), eliminando cualquier lípido que se superpusiera con la proteína. A continuación, se solvató el sistema virtual de proteína-membrana con moléculas de agua TIP3P y se neutralizó añadiendo virtualmente KCl hasta 400 mM. Inicialmente, los parámetros CHARMM 27 [29] se asignaron a todas las moléculas utilizando VMD 1.9 para permitir la adición de la bicapa lipídica, el agua y los iones. Sin embargo, una vez que se preparó cada sistema virtual (tanto la conformación activa como la inactiva) y su respectivo ligando (octopamina para la conformación activa y prometazina para la conformación inactiva) estuvo listo para ser agregado, los parámetros AMBER gaff y ff03.r1 fueron asignados al ligando y el resto de moléculas, respectivamente, utilizando Amber 11 tleap [30-32]. Se eligió el campo de fuerza AMBER porque permite la generación de parámetros para el ligando utilizando el módulo de antecámara [33]. Se añadió un puente disulfuro entre los residuos de Cys93 y Cys194, ya que este puente también existía en los PDB molde.

Cada sistema virtual completo consistió en la respectiva conformación de AgOAR45B incrustado en una gran bicapa de POPC con 168 moléculas de lípidos. En cada sistema virtual, todos los residuos estaban en el estado de protonación normal para el pH fisiológico. Además, el sistema unido al antagonista contenía 171 iones potasio, 204 iones cloruro y 22,525 moléculas de agua para un total de 99,706 átomos (medidos 95 × 96 × 128 Å), mientras que el sistema unido al agonista contenía 172 iones potasio, 205 iones cloruro iones y 22,654 moléculas de agua para un total de 100,077 átomos (medidos 101 × 92 × 127 Å). Antes de las simulaciones de MD, los sistemas se equilibraron utilizando 120 núcleos de CPU de la siguiente manera: 1) MD de colas de lípidos durante 500 picosegundos (ps) [paso de tiempo = 2 femtosegundos (fs)] con proteína, ligando, grupos de cabeza de lípidos, agua e iones mantenidos fijo 2) equilibrio de lípidos, agua e iones durante 500 ps (paso de tiempo = 2fs) con restricciones armónicas en la proteína y ligando 3) equilibrio de todo el sistema durante 500 ps (paso de tiempo = 2fs) sin restricciones moleculares. Después del equilibrio, se realizaron 20-30 ns de simulación MD utilizando 504 núcleos de CPU en incrementos de dos a tres 10 ns, con un paso de tiempo = 2fs y datos de trayectoria que se recopilaron cada 200 ps. Los pasos de equilibrio y simulación se ejecutaron utilizando NAMD 2.8 [34] en el clúster de computación de alto rendimiento Kraken [35].

Preparación de la pantalla virtual

Todos los trabajos de detección virtual se ejecutaron en sus respectivos modelos de homología de "solo proteínas" (es decir, que no contienen lípidos, aguas o iones). Las proteínas se prepararon ejecutando primero el flujo de trabajo del Asistente de preparación de proteínas [36, 37], y luego se generaron cuadrículas utilizando la aplicación Receptor Grid Generation de Glide, cada una de las cuales se encuentra en Maestro de Schrodinger Suite 2011 [38]. Para obtener las poses iniciales del ligando utilizadas en la generación de la cuadrícula, cada una de las conformaciones se superpusieron primero en PyMOL [39] con las plantillas superiores utilizadas por I-TASSER para su creación (2RH1 para la conformación inactiva y 3SN6 para la conformación activa) y las posiciones de los ligandos encontrados en cada una de las plantillas se guardaron primero como un archivo PDB, luego se agregaron usando Maestro de Schrodinger Suite 2011 a su respectiva conformación AgOAR45B (se usó el agonista inverso parcial CAU de 2RH1 para la conformación inactiva y el agonista 30G de 3SN6 para el activo conformación) para indicar el sitio activo de la proteína. El ligando añadido a cada uno de los modelos de homología se utilizó como centroide de la cuadrícula, determinando el área en la que deberían acoplarse las bibliotecas de compuestos. No se utilizaron restricciones.

Cribado virtual con ligandos de GPCR conocidos

Las conformaciones inactiva y activa de AgOAR45B con los ligandos añadidos se utilizaron para construir las rejillas, que luego se ejecutaron en una pantalla virtual utilizando el software Glide de Schrodinger [40-43] contra antagonistas y agonistas de GPCR conocidos, respectivamente. Las estructuras compuestas originales utilizadas en los dos conjuntos de prueba se descargaron del sitio web PubChem de los NIH. Uno de los equipos de prueba contiene agonistas de GPCR conocidos: sinefrina, ácido cinámico, clonidina, demetilclordimeforma, dopamina, eugenol, histamina, nafazolina, norepinefrina, octopamina, fentolamina, serotonina, tolazolina, transanetol y tiramina. El otro contiene antagonistas de GPCR conocidos: rauwolscina, demetilclodimeforma, 8-hidroximianserina, amitriptilina, antazolina, clorpromazina, ciproheptadina, desipramina, desmetilmianserina, dihidroergotamina, gramina, imipramina, maroximidina, prometaminolaminotropinamida, prometaminolaminotropina yohimbina. Luego, cada uno de los conjuntos de prueba se preparó utilizando LigPrep [44] de Schrodinger Maestro para generar diferentes estados de protonación potenciales en un rango de pH de 7-8, tautómeros y conformaciones de anillo. Después de que cada uno de los conjuntos de prueba se acopló a su respectiva conformación AgOAR45B, se guardaron las posiciones de posición superior para el antagonista prometazina y el agonista octopamina y luego se agregaron a las conformaciones inactiva (unida al antagonista) y activa (unida al agonista), respectivamente. Estas conformaciones de proteínas con ligandos acoplados se utilizaron luego como la posición de partida para las simulaciones de MD.

Proyección virtual con biblioteca ZINC

La biblioteca utilizada en el acoplamiento contenía compuestos similares a fármacos de la base de datos en línea ZINC [45]. Los compuestos se prepararon utilizando LigPrep de Schrodinger Maestro para generar diferentes estados de protonación potenciales en un rango de pH de 5-9, tautómeros y conformaciones de anillo. La biblioteca final contenía aproximadamente 12 millones de compuestos. Se dividió en cinco sub-bibliotecas (∼ 2,4 millones de compuestos por sub-biblioteca) para la primera ejecución del cribado virtual de alto rendimiento.

La biblioteca se cribó frente a cinco rejillas de AgOAR45B (dos de las conformaciones unidas al antagonista y tres de las conformaciones unidas al agonista), construidas a partir de las posiciones del receptor después de 20 ns de simulación de MD cada una. El cribado virtual utilizando la biblioteca ZINC se realizó utilizando el software Glide de Schrodinger en tres pasos: 1) cada una de las cinco subbibliotecas se filtró utilizando un cribado virtual de alto rendimiento y los 30.000 compuestos principales de cada subbiblioteca se guardaron y recombinaron creando una biblioteca que contenía 150.000 compuestos 2 ) esta nueva biblioteca se filtró posteriormente utilizando un cribado virtual de precisión estándar y se guardaron los 15.000 compuestos principales y, 3) esta nueva biblioteca se filtró una vez más utilizando un cribado virtual de precisión adicional y los 1.500 compuestos principales se guardaron y analizaron, teniendo en cuenta el puntuación, las interacciones relevantes en el bolsillo del sitio activo y la diversidad en el muestreo para pruebas adicionales.


DESCONECTADO

Lisa Kay Robertson

Una disertación enviada a la Facultad de Graduados de la Universidad Estatal de Carolina del Norte.

En cumplimiento parcial de los Requisitos para el grado de

Doctor en Filosofía. Genética

Dr. James W. Mahaffey, presidente del Comité Asesor,

Dr. Michael D. Purugganan, miembro del comité,

Dr. Jonathan M. Horowitz, miembro del comité, Ciencias Biomédicas Moleculares

Este trabajo está dedicado a mi increíble familia, cuyo amor y apoyo incondicional me permiten conquistar todos los desafíos en mi camino.

A mi papá, quien es mi inspiración constante y quien me formó a través de su vida de excelencia, su carácter inquebrantable y su deseo incesante de aprender.

Reconozco y extiendo mi más sincero agradecimiento al Departamento de Genética por la increíble oportunidad que me han brindado. Estoy muy agradecido por el consejo y la orientación de mi asesor, Jim Mahaffey, y los miembros de mi comité asesor: Amy Bejsovec, Michael Purugganan y Jon Horowitz.

También debo agradecer a todos los miembros del Mahaffey Lab, pasados ​​y presentes, por su amistad y ayuda. En particular, agradezco a Kate Lingerfeld, Dana Bowling, Jamie Mahaffey y Mark Shepherd por sus esfuerzos y contribuciones a mi investigación. Muk Patel por sus habilidades moleculares superiores y su memoria de trampa de acero Barbara Imiolczyk por todos sus consejos y a nuestra maravillosamente eficiente gerente de laboratorio, Jennifer. Hutchinson, por todo lo que hace para mantener el laboratorio en funcionamiento.

También debo expresar mi agradecimiento a los miembros de los laboratorios Brown y Denell en la Universidad Estatal de Kansas por su generoso intercambio de ADN, protocolos de Tribolium y consejos sobre las disputas de escarabajos. También agradezco a Bijan Dey en el laboratorio de Campos en la Universidad McMaster por compartir autoría, líneas de vuelo e información sobre desconectado.

CAPÍTULO UNO: Introducción general. 1

CAPÍTULO DOS: Genes HOM-C de insectos y desarrollo: lecciones de Drosophila y más allá. 5

Introducción — Drosophila Hom-C / Hox Genes. 7

La expresión embrionaria y fenotipos mutantes de peines deformados y sexuales reducidos en Drosophila y Tribolium. dieciséis

La iniciación de peines deformados y sexuales redujo la expresión en Drosophila. 22

Mantenimiento de la expresión de Dfd y Scr en Drosophila. 23

Regulación postraduccional de SCR. 26

Regulación entre las proteínas HOM-C: regulación automática y cruzada de DFD y SCR. 26

El Homeodominio de la Proteína Hom-C. 28

Función de la proteína Hom-C. 30

Especificidad funcional del Homeodominio Hom-C. 32

Interacciones cooperativas entre proteínas Hom-C y otros factores. 35

Extradenticle es un cofactor de proteína Hom-C. 38

El motivo YPWM (hexapéptido) y la formación del heterodímero Exd / Hom-C. 41

El homotórax forma un trímero con proteínas Exd y Hom-C. 42

Como cofactor, la extradentícula es insuficiente para explicar completamente la función de la proteína Hom-C. 42

Otros cofactores potenciales de la proteína Hom-C: cuello, líneas y apóntico. 44

Co-factores potenciales de proteína de dedo de zinc C2H2. 45

El enfoque de esta investigación. 48

CAPÍTULO TRES: Expresión del gen de Drosophila desconectado mediante el sistema UAS / GAL4

CAPÍTULO CUATRO: Una red interactiva de proteínas con dedos de zinc contribuye a la regionalización del embrión de Drosophila y establece los dominios de la función de la proteína Hom-C. 81

Materiales y métodos . 86

Se requieren tanto Disco como Dfd para especificar la identidad maxilar. 87

Tsh reprime Disco durante el desarrollo normal del segmento del tronco. 90

Ectópico Disco altera el desarrollo del tronco. 95

Disco y Scr pueden activar genes diana Scr. 100

CAPÍTULO CINCO: La expresión del gigante del gen gap de Drosophila establece el límite del tronco gnathal a través de la activación y el posicionamiento de los factores de tagmosis de dedo de zinc C2H2 desconectados y teashirt. 114

Materiales y métodos . 119

La distribución del ARNm disco se altera en mutantes genéticos de patrones de acción temprana. 120

La distribución del ARNm de tsh está alterada en mutantes gap. 125

Las alteraciones en la expresión disco y tsh en mutantes gt sugieren una transformación homeótica del segmento labial. 129

La expresión del gen homeótico está alterada en embriones mutantes gt. 136

tsh es necesario para la transformación de gnathal en tronco en mutantes gt. 139

Antp no es necesaria para la expresión epidérmica ectópica de tsh en los segmentos gnathal. 140

El dominio gt anterior funciona en la identidad del segmento, además de la segmentación. 142

La función del dominio gt anterior en Drosophila es similar a Tribolium. 145

La expresión gt establece el límite entre gnathal y tronco mediante la regulación de tsh y disco. 146

CAPÍTULO SEIS: Caracterización funcional del homólogo desconectado en el escarabajo coleóptero Tribolium castaneum. 159

Materiales y métodos . 163

Aislamiento, estructura y conservación evolutiva de Tc’disco. 165

Tc’disco se expresa en los apéndices durante el desarrollo embrionario. 167

Se requiere Tc’disco para el patrón y elongación adecuados de los apéndices embrionarios. 178

Se requiere Tc’disco para el patrón y elongación adecuados de los apéndices de los adultos. 181

Tc’Disco es miembro de una familia de dedos de zinc C2H2 conservados evolutivamente. 182

La expresión embrionaria de Tc’disco es similar a la expresión embrionaria de Dm’disco. 185

Tc’disco funciona en el desarrollo de apéndices de Tribolium. 188

Posibles roles para Tc’disco en el desarrollo del apéndice de Tribolium. 189

CAPÍTULO SIETE: Resumen y perspectivas. 199

Resumen y mirando hacia el futuro. 200

Conclusiones y sugerencias para trabajos futuros. 201

Tabla 1: Los efectos de los genes examinados sobre la acumulación de ARNm disco. 121

Figura 1: La organización molecular del complejo homeótico de Drosophila

Figura 2: Consecuencias fenotípicas de las mutaciones de Insect Hom-C. 10

Figura 3: Expresión del gen Regional Hom-C en embriones de Drosophila. 13

Figura 4: Segmentos, Parasegmentos y Compartimentos. 15

Figura 5: Estructuras de la cabeza larvaria de Drosophila. 18

Figura 6: Homeodominio de la proteína Hom-C. 31

CAPÍTULO TRES Figura 1: Localización de ARNm embrionario in situ de disco endógeno y UAS-discoM expresión . 73

Figura 2: Imágenes de microscopía de contraste de fase de preparaciones de cutícula de tipo salvaje y UAS-discoM, armadillo-GAL4. 75

Figura 3: Micrografías electrónicas de barrido ambiental (ESEM) de ojos compuestos que comparan el tipo salvaje y UAS-discoC expresando individuos. 77

CAPÍTULO CUATRO Figura 1: Disco y Dfd son necesarios para la identidad maxilar. 88

Figura 2: La transformación de tronco a gnathal es más completa en embriones mutantes tsh. 91

Figura 3: El papel de Tsh en la distribución de ARNm disco. 93

Figura 4: Las proteínas Hom-C se acumulan en el registro adecuado en embriones con Dfd y Disco ectópicos pero que carecen de Tsh. 96

Figura 5: El cierre dorsal está bloqueado por la expresión prd »disco. 98

Figura 6: Ectópico Disco altera los segmentos del tronco. 101

Figura 7: Activación del gen diana Scr, PB, por disco y Scr expresados ​​ectópicamente. 103

Figura 8: Una jerarquía interactiva de factores de transcripción de dedos de zinc establece los tipos de segmento de tronco y gnathal / cabeza. 109

CAPÍTULO CINCO Figura 1: La expresión espacial de disco se ve afectada por mutaciones en hb, Kr y gt. 122

Figura 2: acumulación de ARNm de tsh en embriones mutantes hb, Kr y gt. 126

Figura 3: El análisis de la cutícula de embriones mutantes gt hemicigóticos revela la homeosis del segmento labial. 131

Figura 5: Alteraciones en la expresión del gen Hom-C / Hox en gtQ292 embriones mutantes

indican un cambio homeótico en la identidad labial. 138

Figura 6: se requiere tsh para la homeosis del segmento labial en mutantes gtQ292. 142

Figura 7: El gigante del gen gap tiene funciones homeóticas y funciones de segmentación. 151

CAPÍTULO SEIS Figura 1: La secuencia de proteínas predicha para Tc’Disco. 166

Figura 2: Acumulación de ARNm de Tc’disco en los embriones de Tribolium. 168

Figura 3: Preparación de la cutícula de patas larvarias de Tc’disco RNAi. 172

Figura 4: Preparación de la cutícula de los apéndices de la cabeza larvaria de Tc’disco RNAi. 175

Figura 5: Se requiere Tc’disco para un patrón y alargamiento adecuados de los apéndices adultos. 179

Figura 6: Un análisis filogenético de regiones con dedos de zinc de la familia de proteínas Disco. 184

Figura 7: Comparación de la acumulación de transcripciones de disco, en la etapa extendida del germband, entre Drosophila y Tribolium. 186

Figura 8: Un posible modelo para la regulación y función de Tc'disco en el desarrollo del apéndice larvario. 192

CAPÍTULO SIETE Figura 1: Posibles modelos mecanicistas para el control Hox / Zinc Finger de la transcripción del gen diana. 204

CAPÍTULO UNO

Aunque previamente se aislaron mutaciones en el Complejo Homeótico (Hom-C) de Drosophila melanogaster (la mosca de la fruta), no fue hasta un informe de 1978 de la revista Nature de Edward B. Lewis que estos genes fueron reconocidos como parte de un complejo de genes requeridos para patrón anteroposterior adecuado del embrión de Drosophila (Lewis 1978). El trabajo adicional de los laboratorios de Kaufman y McGinnis expandió el número de genes Hom-C identificados a ocho (Kaufman et al. 1980) e identificó una secuencia altamente conservada llamada homeobox. Esta secuencia codifica un motivo de unión al ADN, llamado homeodominio (McGinnis et al. 1984). Desde entonces, ha habido una extensa investigación sobre la conservación y función de estos factores de transcripción en muchas especies animales diferentes (Reseñas en McGinnis y Krumlauf 1992 Gellon y McGinnis 1998 Veraksa et al. 2000). Estos genes (generalmente llamados genes Homeobox (Hox)) desempeñan un papel crucial en el desarrollo embrionario y los patrones en prácticamente todos los animales, y probablemente son la base de la diversidad evolutiva y del desarrollo en el reino animal (Castelli-Gair 1998 Hughes y Kaufman 2002 Prince 2002). Los genes Hox que codifican estas proteínas se conservan en una disposición genómica agrupada que suele ser colineal con sus dominios de expresión anterior / posterior. También llamados genes “selectores” (García-Bellido 1977), los genes Hox codifican factores de transcripción que se presume regulan cascadas genéticas específicas para conferir identidades regionales precisas y únicas a lo largo del eje anterior / posterior del cuerpo. Debido a que diferentes proteínas Hox pueden unirse a secuencias de ADN diana muy similares, ya veces idénticas, es probable que los cofactores desempeñen un papel en la orientación de la especificidad funcional de la proteína Hox durante el desarrollo animal. Sin embargo, se han identificado pocos de estos cofactores.

la función de disco durante el desarrollo embrionario, y ¿cómo funcionan las proteínas Disco codificadas con las proteínas Hox para dirigir patrones? En segundo lugar, ¿qué factores aguas arriba regulan la expresión espacial y temporal de disco y disco-r durante el desarrollo embrionario? Finalmente, dado que los homólogos disco se encuentran en diversos filos animales, al igual que los genes Hox, ¿se conserva también la función del cofactor Hox? Estas preguntas se examinan utilizando los organismos modelo Drosophila melanogaster y Tribolium castaneum (el escarabajo rojo de la harina).

El siguiente capítulo de este trabajo ofrece una descripción completa de la función de la proteína Hom-C / Hox en Drosophila y otros insectos, y describe las preguntas que quedan con respecto a la función de la proteína Hox. A continuación se presenta la presentación de los resultados de la expresión ectópica y el análisis genético utilizados para explorar la función disco en Drosophila. La expresión disco se muestra para definir dominios en los que pueden funcionar Dfd y Scr. También se demuestra que disco tiene un papel de patrón embrionario regional como parte de una red interactiva de proteínas de dedos de zinc C2H2 que incluye el gen de patrón del tronco y el cofactor Hox del tronco, teashirt (tsh). Los resultados de este trabajo conducen a la propuesta de un modelo para la función de la proteína Hox en Drosophila en el que diferentes combinaciones de proteínas con dedos de zinc C2H2 expresadas regionalmente y proteínas Hox confieren identidades de segmento específicas a lo largo del eje del cuerpo embrionario. A continuación, se presentan los resultados de una pantalla para los reguladores aguas arriba de disco y tsh, y se muestra que el gigante del gen gap (gt) es clave para establecer los límites de expresión de estos dos genes para definir el límite gnathal / tronco embrionario de Drosophila. La regulación de disco y tsh por Gt subyace a un papel de identidad de segmento no reconocido previamente para la proteína Gt en su dominio de expresión anterior. Finalmente, se presenta la identificación y caracterización de un homólogo disco de Tribolium. El patrón de expresión embrionario de Tribolium disco se examina y se compara con la expresión de disco de Drosophila. Las funciones de desarrollo embrionarias y adultas del gen disco Tribolium se investigan utilizando la interferencia de ARN parental y larval, y los resultados revelan un papel significativo para el gen Tribolium en el patrón y elongación de los apéndices. Este trabajo se concluye con un resumen del trabajo, conjeturas sobre la conservación evolutiva de la función disco y perspectivas para trabajos futuros.

Castelli-Gair, J. (1998). Implicaciones de la regulación espacial y temporal de los genes Hox en el desarrollo y la evolución. Int J Dev Biol. 42: 437-444.

García-Bellido, A. (1977). Mutaciones homoeóticas y atávicas en insectos. Amer. Zool. 17: 613-629.

Gellon, G. y McGinnis, W. (1998). Dar forma a los planes corporales de los animales en desarrollo y evolución mediante la modulación de los patrones de expresión de Hox. Bioensayos 20 (2): 116-125.

Heilig, J. S., Freeman, M., Laverty, T., Lee, K. J., Campos, A. R., et al. (1991). Aislamiento y caracterización del gen desconectado de Drosophila melanogaster. Embo J 10 (4): 809-815.

Hughes, C. L. y Kaufman, T. C. (2002). Genes Hox y la evolución del plan corporal de los artrópodos. Evolución y desarrollo de ampamp 4 (6): 459-499.

Kaufman, T. C., Lewis, R. y Wakimoto, B. (1980). Análisis citogenético del cromosoma 3 en Drosophila melanogaster: el complejo de genes homoeóticos en el intervalo cromosómico politeno 84 A-B. Genética 94: 115-133.

Lewis, E. B. (1978). Un complejo de genes que controla la segmentación en Drosophila. Nature 276 (5688): 565-570.

Mahaffey, J. W., Griswold, C. M. y Cao, Q. M. (2001). Los genes de Drosophila desconectados y relacionados con la disco son redundantes con respecto al desarrollo de la cabeza de las larvas y la acumulación de ARNm de genes diana deformados. Genética 157 (1): 225-236.

McGinnis, W. y Krumlauf, R. (1992). Genes homeobox y patrones axiales. Celda 68 (2): 283-302.

McGinnis, W., Levine, M. S., Hafen, E., Kuroiwa, A. y Gehring, W. J. (1984). Una secuencia de ADN conservada en genes homoeóticos de los complejos de Drosophila Antennapedia y bithorax. Nature 308 (5958): 428-433.

Prince, V. E. (2002). La paradoja de Hox: más compleja (s) de lo imaginado. Biología del desarrollo 249 (1): 1-15.

Steller, H., Fischbach, K. F. y Rubin, G. M. (1987). Desconectado: un locus necesario para la formación de vías neuronales en el sistema visual de Drosophila. Celda 50 (7): 1139-1153.

CAPITULO DOS

Insecto

Genes y desarrollo

Genes de insectos Hom-C y desarrollo: lecciones de Drosophila y

Más allá de

Lisa K. Robertson y James W. Mahaffey

Departamento de Genética Campus de la Universidad Estatal de Carolina del Norte Box 7614

Correo electrónico: [email protected] [email protected] Teléfono de la oficina: 919-515-5791

Teléfono del laboratorio: 919-515-5815 Fax: 919-515-3355

LOS GENES DROSOPHILA HOM-C / HOX

La palabra homeótica tiene su origen en la palabra griega homoios, que significa similar. William Bateson acuñó el término "homeosis" en 1894 para describir una mutación que transforma una estructura a semejanza de otra, particularmente con respecto a sistemas repetidos como segmentos, pétalos / sépalos / estambres, vértebras, etc. En la genética de Drosophila, el término se utiliza para describir una mutación que hace que un segmento pierda su identidad normal y adopte la apariencia de otro segmento. Hay muchas mutaciones homeóticas esparcidas por todo el genoma de Drosophila, pero dos regiones en el brazo derecho del tercer cromosoma son únicas. Estos dos grupos de genes homeóticos, el Complejo Antennapedia (Ant-C) y el Complejo Bithorax (Bx-C), se denominan conjuntamente Complejo Homeótico (Hom-C) o Complejo Hox (Figura 1). Los genes Hom-C de Drosophila Ant-C son labial (lab), proboscipedia (pb), Deformed (Dfd), Sex combs reducidos (Scr) y Antennapedia (Antp) 1. Los genes Hom-C de Drosophila Bx-C son Ultrabithorax (Ubx), abdominal-A (abd-abdominal-A) y Abdominal-B (Abd-B). La organización genómica y los patrones de expresión regionales de estos genes son colineales en el embrión de Drosophila en general, el dominio de expresión de un gen a lo largo del eje anterior-posterior del cuerpo se correlaciona con su posición genómica dentro de los complejos.

Los genes Hom-C / Hox actúan para dirigir identidades de segmentos específicos a lo largo del eje del cuerpo anterior / posterior del insecto, y la pérdida o misexpresión de un gen Hom-C / Hox suele ser suficiente para transformar regiones de todo el cuerpo en una identidad segmentaria diferente. En la Figura 2 se muestran dos ejemplos de tales transformaciones homeóticas en Drosophila. En la imagen se muestra una ganancia de función del mutante de Drosophila Antennapedia (Antp), en la que las antenas se transforman en patas. También se muestra una larva en etapa terminal de Antp con pérdida de función, que muestra una transformación del segundo y tercer segmento torácico hacia una primera identidad. Sin duda, Drosophila melanogaster es el organismo más estudiado en lo que respecta a los genes Hom-C. Estos poderosos factores de transcripción se identificaron y caracterizaron inicialmente en la mosca de la fruta, y gran parte de lo que se conoce sobre su estructura, regulación y función proviene de estos estudios.

1 Tenga en cuenta que los nombres de los genes de Drosophila siguen una nomenclatura estándar; los genes generalmente reciben el nombre del fenotipo mutante y

Figura 2: Consecuencias fenotípicas de las mutaciones de Insect Hom-C

Tanto las mutaciones de pérdida de función (D, E) como las de ganancia de función (B) en los genes Hom-C pueden tener efectos fenotípicos dramáticos en Tribolium y Drosophila. Una micrografía electrónica de barrido de un tipo salvaje (A) y una cabeza de Drosophila adulta mutante (B). La activación ectópica de Antp en las antenas (ANT) provoca la transformación en una segunda pierna torácica (HOM LEG). En una larva de Drosophila de primer estadio de tipo salvaje (C), los tres segmentos torácicos diferencian el dentículo característico

patrones. Los primeros dentículos torácicos incluyen un cinturón principal (marcado con una flecha) y un segundo parche pequeño de dentículos llamado "barba" (marcado con un asterisco). La morfología de los primeros dentículos torácicos difiere de la del segundo y tercer segmento, siendo este último más pequeño y fino. En la cutícula de una larva en etapa terminal que carece de Antp (D), el segundo y tercer segmento torácico se transforman hacia una primera identidad torácica. Obsérvese la aparición de una barba en el segundo cinturón de dentículos torácicos (marcado con un asterisco) y el cambio morfológico del segundo y tercer dentículos torácicos a un primer tipo torácico (flechas). Fluorescente,

imágenes deconvolucionadas de un tipo salvaje (E) y un TcDfd1 / TcDfd1 larva mutante de Tribolium (F). Normal

las antenas (ANT), las mandíbulas (MN), los palpos maxilares (MAX) y los palpos labiales (Lab) son visibles en la larva de tipo salvaje. En una larva que carece de la función TcDfd (F), las mandíbulas se transforman en antenas homeóticas (HOM ANT). Créditos de las fotos: Imágenes de Tribolium cortesía de S.J. Marrón. Imágenes de la cabeza de Drosophila cortesía de Fly Base (Drysdale et al.2005):

Los complejos HOX se conservan en prácticamente todos los animales, al igual que las funciones de patrón axial y la relación colineal entre los patrones de expresión y la disposición genómica. El escarabajo coleóptero, Tribolium castaneum (escarabajo rojo de la harina) representa la especie de insecto no drosófilo mejor caracterizada. Numerosos estudios han caracterizado fenotipos mutantes, patrones de expresión y la estructura genómica de los genes Tribolium HOM-C, lo que convierte a este insecto en un modelo excelente para estudios comparativos con Drosophila. Se estima que los dos tienen aproximadamente 300 millones de años de divergencia de su último ancestro común (Brown et al. 1999b). Como en la mayoría de las especies animales (distintas de Drosophila), los genes Tribolium HOM-C se agrupan en un solo complejo, a diferencia de los complejos divididos observados en varias especies de Drosophila (Beeman 1987 Ferrier y Akam 1996 Davenport et al.2000 Powers et al. 2000 Cook et al.2001 Negre et al.2003). El tamaño de los grupos de HOM-C varía entre las dos especies de insectos. Por ejemplo, la porción del complejo de Tribolium correspondiente al ANT-C de Drosophila es aproximadamente 279 kb, mientras que la misma región en Drosophila incluye aproximadamente 439 kb (Brown et al. 2002).

Figura 3: Expresión del gen Regional Hom-C en embriones de Drosophila

Figura 4: Segmentos, Parasegmentos y Compartimentos

al ectodermo. Los dominios de expresión del gen HOM-C pueden solaparse en el ectodermo, pero sus dominios de expresión en el mesodermo visceral son mutuamente excluyentes (Treisman et al. 1989). Como se indica en la discusión a continuación, la expresión del gen HOM-C dentro del SNC también se desplaza con frecuencia, aunque solo en la mitad de un segmento, de modo que los límites de expresión son parasegmentales. Dfd es una excepción, con sus límites de expresión desplazándose anteriormente tanto en el mesodermo visceral como en el SNC (Martínez-Arias et al. 1987).

La expresión embrionaria y los fenotipos mutantes de los peines sexuales y deformados reducidos en Drosophila y Tribolium

Dos genes Hom-C son fundamentales para este estudio: deformado (Dfd) y Sex Combs Reduced (Scr). Sus patrones de expresión y fenotipos mutantes están bien caracterizados tanto en Drosophila como en Tribolium, aunque los estudios en la mosca de la fruta son más completos. A continuación se presenta un breve resumen del conocimiento actual sobre Dfd y Scr en cada uno de estos organismos.

Se requiere Dfd para el desarrollo adecuado de los segmentos mandibular y maxilar de Drosophila (Wakimoto et al. 1984), así como para la especificación adecuada del destino celular dentro del cerebro embrionario (Hirth et al. 1998 Hirth et al. 2001). El trabajo de Wakimoto y Kaufman (1984) identificó el requisito de Dfd en la especificación de la cabeza embrionaria. El gen Dfd abarca aproximadamente 11 Kb, que tiene cinco exones, que producen una única transcripción de 2,8 kb y una proteína de 586 aminoácidos (Regulski et al. 1987). Dfd es el primer gen de Hom-C que se expresa, y la proteína se detecta por primera vez en la etapa de blastodermo celular (Mahaffey et al. 1989). La expresión embrionaria temprana de Dfd rodea al embrión y abarca el surco cefálico. Posteriormente, la acumulación se detecta de forma transitoria en los primordios de los lóbulos hipofaringiales y en el segmento mandibular y maxilar en desarrollo. La expresión en el SNC y el mesodermo está compensada anteriormente, de modo que la expresión mesodérmica y neural es parasegmentaria. La expresión de Dfd también está presente en las células entre la cresta dorsal en desarrollo y el lóbulo óptico. Por la contracción tardía de la banda germinal, Dfd se expresa fuertemente en las células dentro del saco frontal que contribuirán a los discos del ojo / antenal de las larvas.

y no se internalizan durante la involución de la cabeza2. Estructuras cefalofaríngeas perdidas o reducidas incluyen los ganchos de la boca, la pieza en H, los cirros maxilares, los órganos sensoriales maxilares y porciones del complejo sensorial antenal-maxilar. La Figura 5 muestra una representación gráfica de la cabeza larvaria de Drosophila y sus estructuras cefalofaríngeas.

Se clonó y caracterizó un homólogo de Dfd, TcDfd, en Tribolium (Brown et al. 1999a). Como Drosophila, TcDfd es el primer gen Hom-C expresado en el embrión en desarrollo. En general, la expresión embrionaria es similar a la de las moscas, estando presente en los segmentos mandibular y maxilar, sus apéndices y la cresta dorsal, pero a diferencia de Drosophila, las transcripciones de TcDfd son evidentes en la serosa extraembrionaria. A medida que se desarrollan los apéndices maxilar y mandibular, la expresión de TcDfd se modula y parece más débil en los apéndices mandibulares.

La función embrionaria de TcDfd se investigó utilizando tanto análisis genético como interferencia de ARN (ARNi) (Brown et al. 2000). A diferencia de Drosophila, que no exhibe transformación homeótica en mutantes nulos de Dfd, la pérdida de TcDfd en Tribolium transforma los apéndices mandibulares en antenas y elimina los enditos de los coxopoditos maxilares (Figura 2F). El agotamiento de un homólogo de Dfd, Of'Dfd, en Oncopeltus fasciatus (chinche del algodoncillo) da como resultado la transformación tanto del segmento maxilar como del segmento mandibular hacia una antena (Hughes y Kaufman 2000), y se ha sugerido que la antena puede representar una 'estado fundamental' para la identidad del segmento gnathal (Stuart et al. 1991). Sin embargo, las diferencias observadas entre los mutantes Dfd de Drosophila y la pérdida de Dfd en otros insectos pueden reflejar simplemente el hecho de que no hay apéndices larvarios en Drosophila. Los fenotipos de moscas y otros insectos pueden, por lo tanto, representar alteraciones del desarrollo equivalentes, aunque se debe tener cuidado al interpretar cualquier fenotipo como "estado fundamental", ya que es probable que algunos genes de patrón todavía estén presentes para influir en el desarrollo de apéndices.

La conservación de la función Dfd a través de phyla se probó expresando ectópicamente TcDfd en embriones de Drosophila en desarrollo (Brown et al. 1999a). Anteriormente se demostró que la Dfd endógena expresada ectópicamente activaría automáticamente la transcripción de Dfd epidérmica en la

Figura 5: Estructuras de la cabeza larvaria de Drosophila

Las estructuras cuticulares y cefalofaríngeas de la cabeza larvaria de Drosophila y los primeros segmentos torácicos. Abreviaturas, seguidas del origen segmentario: dw: ala dorsal, latp Acron: pieza enrejada (puente dorsal), Acron vb: puente vertical, Acron es: esclerita epifaríngea, Labral mt: diente mediano, Labral anso: órgano sensorial antenal, Antennal ppw —Pared faríngea posterior, LP intercalar — apófisis lateral, vw mandibular — ala ventral, tr mandibular — costillas en T, mh mandibular — gancho bucal, mandibular (punta) / maxilar (base) mxso — órgano sensorial maxilar, dmp maxilar — dorsal papila medial del mxso, dlp antenal: papila dorsal-lateral del mxso, ci mandibular: cirros maxilares, vo maxilar: órgano ventral, ds maxilar: esclerito dental, hs maxilar: esclerito hipostómico (pieza en H), db labial: dentículo cinturón, Torácico db-a - primer cinturón torácico anterior, Torácico db-p - primer cinturón torácico posterior, Torácico ki - órganos de keilin, Torácico bd - ventral kolbchen (órganos de puntos negros), Torácico. (Jürgens et al., 1986, The Fly Base

región ventral posterior de los segmentos labial, tronco y abdominal (Kuziora y McGinnis 1988). El transgén de TcDfd, impulsado por un promotor de choque térmico, también fue capaz de activar la transcripción de Dfd endógena en un patrón muy similar (Brown et al. 1999a). También dirigió la expresión de un elemento autorregulador Dfd, fusionado a LacZ. Finalmente, la expresión de TcDfd, en embriones de Drosophila que carecen de una proteína Dfd funcional, fue capaz de rescatar parcialmente el fenotipo embrionario nulo de Dfd y lo hizo en la misma medida que la expresión ectópica del gen endógeno. Estos estudios ilustran la fuerte conservación de la función entre los genes Hom-C en diferentes especies.

Abarcando alrededor de 100 kb, Drosophila Scr codifica al menos cuatro transcripciones separadas derivadas del corte y empalme alternativo de cuatro exones (Andrew 1995). Una gran parte de la región reguladora de Scr está separada de la región de codificación por el gen de segmentación ftz (Figura 1). Las mutaciones que afectan la función embrionaria son 5 'del gen ftz, más cerca de la unidad de transcripción Scr, mientras que las lesiones semiletales mapean 3' del gen ftz, hacia Antp (Pattatucci y Kaufman 1991 Pattatucci et al. 1991). El producto de la proteína Scr tiene 417 aminoácidos con un peso molecular de 44 kDa (Andrew 1995).

Scr es un gen particularmente interesante, ya que controla la identidad del segmento en dos tagma diferentes del embrión de Drosophila: el segmento gnathal labial y el primer segmento contiguo del tronco torácico. Las transcripciones de scr se detectan por primera vez cuando comienza la gastrulación y continúan presentes durante el resto de la embriogénesis (Martínez-Arias et al. 1987). Aunque se retrasa 2-3 horas con respecto a la localización del ARN, la acumulación de proteínas sigue el patrón de las transcripciones de ARN, que se encuentran a lo largo de los lóbulos labiales y la mitad anterior del primer segmento torácico (Mahaffey y Kaufman 1987). Además, algunas células de la cresta dorsal también expresan la proteína Scr. A medida que la banda germinal comienza a contraerse, la proteína Scr se acumula en el mesodermo visceral del intestino medio (Tremml y Bienz 1989 Reuter y Scott 1990). Scr también se acumula en los primordios de las glándulas salivales embrionarias antes de su invaginación, sin embargo, Scr está completamente ausente después de la invaginación de las glándulas en desarrollo (Reuter y Scott 1990).

genes, no hay transformación homeótica larvaria del segmento labial correspondiente a la ausencia de Scr. La pérdida de Scr elimina las estructuras generadas por el segmento labial: las glándulas salivales y el puente de la pieza en H (Panzer et al. 1992).

Tanto la expresión como la función del homólogo Scr aparecen conservadas en Tribolium (Curtis et al. 2001 DeCamillis et al. 2001). El gen del cefalotórax (Cx) tiene un tamaño de aproximadamente 22 Kb y contiene tres exones. Cx está flanqueado por TcDfd y TcFtz, como en Drosophila, y produce una única transcripción de 1,9 Kb. Cx se expresa a medida que se condensa el rudimento de la banda germinal, en el ectodermo del parasegmento 2 (maxilar posterior / labial anterior). A medida que continúa el desarrollo, las transcripciones de Cx se acumulan intensamente en el mesodermo del primer segmento torácico y, en menor grado, en el mesodermo del segundo y tercer segmento torácico. A medida que comienzan a formarse los apéndices, Cx se expresa en el ectodermo de los primordios del apéndice labial. Finalmente, cuando la banda germinal está completamente retraída, las transcripciones de Cx están presentes en la base de los apéndices labiales, en unas pocas células en el mesodermo mandibular, en unas pocas células en el compartimento posterior de la extremidad maxilar, la porción dorsal anterior. del primer segmento torácico, y en un patrón repetido segmentariamente en el sistema nervioso central en desarrollo (Curtis et al. 2001).

Se utilizó análisis genético y ARNi para estudiar el papel del homólogo de Scr, Cefalotórax (Cx), en Tribolium. Hay dos clases de mutaciones en el gen Cx de Tribolium (Beeman et al. 1989 Curtis et al. 2001). Se usó ARNi para determinar cuál es probable que sea el fenotipo nulo, y esto es una transformación del labio en antenas y una fusión del primer segmento torácico con la cabeza (Curtis et al. 2001). Curiosamente, la transformación de labio a antenas se observa en adultos de Drosophila solo cuando se eliminan tanto pb como Scr (Percival-Smith et al. 1997). La segunda clase de fenotipo Cx es más complicada, lo que hace que el labio adquiera una identidad maxilar y una duplicación del primer segmento torácico (Beeman et al. 1989). La razón de esta transformación aún no está clara.

la expresión son letales y van acompañadas de graves defectos morfológicos, e incluso cuando se producen adultos viables, la aptitud puede verse muy afectada. Por lo tanto, el estricto control espacial y temporal de los genes selectores de Hom-C es fundamental para el patrón normal del cuerpo.

La estructura genómica agrupada de los genes Hom-C y la expresión colineal son bastante únicas en su fuerte conservación a través de phyla. Esto plantea la pregunta: ¿por qué los genes Hom-C / Hox se encuentran en arreglos tan altamente conservados y es esto un requisito para su expresión y función? Los estudios en vertebrados revelan regiones reguladoras Hox compartidas e indican que los cambios en la disposición del complejo pueden afectar la expresión de múltiples genes Hox (Gould et al. 1997 Sharpe et al. 1998). Esa división en el grupo Hom-C / Hox solo se ha observado (hasta ahora) en (Von Allmen et al. 1996 Adams et al. 2000 Negre et al. 2003 Negre et al. 2005) y en el nematodo Caenorhabditis elegans ( Ruvkun y Hobert 1998), sugiere una fuerte restricción evolutiva para el grupo ordenado Hom-C / Hox, y quizás una relajación de esta restricción en estos dos organismos, en los que no se han identificado regiones reguladoras del gen Hom-C compartidas. La conservación de la organización genómica agrupada y ordenada puede ser necesaria para la colinealidad temporal y espacial observada en la expresión de Hom-C (van der Hoeven et al.1996 Kondo y Duboule 1999), aunque el mecanismo subyacente a este requisito aún no se ha determinado. (Kmita y Duboule 2003). A pesar de estas preguntas, se comprenden algunos mecanismos de regulación del gen Hom-C en Drosophila.

Inicio de la expresión de Dfd y Scr en Drosophila

En el embrión de Drosophila, el establecimiento de la expresión temprana de Hom-C ocurre durante la etapa de blastodermo celular sincitial o temprano y está controlado por los productos génicos de segmentación y brecha ascendente temprana. Varios estudios han demostrado la regulación de la expresión de Dfd y Scr por estos productos génicos de acción temprana y otros factores.

La actividad temprana de Dfd no se ve afectada significativamente por cambios en los genes de la brecha cigótica, pero las mutaciones en los genes de la regla del par sí afectan la expresión de Dfd (Jack et al. 1988). Las mutaciones en hairy, runt, even-skipped (eve), fushi tarazu (ftz), paired (prd), impares-paired (opa), impar-skipped (impar) y engrailed (en) afectan la expresión Dfd. Los mutantes odd y ftz permiten una expansión espacial de la expresión de Dfd, lo que indica una regulación negativa de Dfd por estos productos génicos. Los mutantes restantes contraen la expresión de Dfd en diversos grados, lo que indica un papel en la activación temprana de Dfd. Se ha informado de alguna entrada de genes gap en la regulación de Dfd. Los embriones que carecen del gen gap, sin cola (tll), exhiben un parche ectópico transitorio de Dfd, justo anterior a su dominio de expresión normal en el surco cefálico anágeno, y se cree que este parche contribuye al agrandamiento de la cresta dorsal a expensas de el lóbulo óptico (Reinitz y Levine 1990). Esto puede ocurrir por la acción de ftz, que también se expresa mal en los mutantes tll. Jack y McGinnis exploraron los efectos combinatorios del gen bicoide del efecto materno (bcd), el gen gap jorobado (hb) y el gen de la regla del par eve, sobre la expresión de Dfd (Jack y McGinnis 1990). En su modelo, la secuencia reguladora Dfd integra tres niveles de la jerarquía de segmentación embrionaria (una concentración intermedia del gen materno, bcd en combinación con el gen gap, hb y los genes de la regla del par eve y ftz) para lograr la activación y el posicionamiento apropiados de Dfd. Cada uno de estos genes codifica factores de transcripción, por lo que su efecto sobre la transcripción de Dfd puede ser directo.

han sido propuestos como posibles miembros de un grupo de genes primordial Hox (McGinnis y Krumlauf 1992 Macías y Morata 1996 Gallitano-Mendel y Finkelstein 1998).

El trabajo anterior sugiere un papel combinatorio para los genes de patrones tempranos en el inicio de la expresión de Scr. Se demostró que el gen de segmentación de reglas de pares, ftz, era necesario para la activación inicial de Scr (Riley et al. 1987), y la pérdida de la expresión de hb tanto materna como cigótica afecta la ubicación espacial de la expresión de Scr. Un trabajo más reciente demuestra un papel directo de la Hb en la activación de Antp, y los autores proponen que esto también podría ser cierto para la proteína gap, Giant (GT) en la activación de Scr (Wu et al. 2001).

Mantenimiento de la expresión de Dfd y Scr en Drosophila

El mantenimiento de la expresión o represión del gen Drosophila Hom-C es necesario más allá de las primeras etapas de la embriogénesis, después de que se hayan disipado los productos génicos de modelado temprano. Debido a que las células continúan expresando los genes Hom-C en patrones espacialmente restringidos durante todo el desarrollo, las células deben "recordar" su estado de transcripción Hom-C para evitar la activación inapropiada o la pérdida de la función del gen selector. Esta retención a largo plazo del estado de transcripción de Hom-C es asumida por dos grandes grupos de proteínas que actúan en trans: el Grupo Polycomb (PcG) (Simon 1995) mantiene los genes Hom-C en un estado reprimido, mientras que el Grupo Trithorax ( TRX) (Ingham 1998) mantiene los genes en un estado activo. Tanto las proteínas del grupo TRX como las del grupo PcG están ampliamente conservadas entre Drosophila y mamíferos (Muller et al. 1995 Simon 1995).

formación de una estructura de cromatina de orden superior asociada con la metilación de histonas (Cao et al. 2002). Los PRE no tienen una secuencia de ADN de consenso reconocible específica (Jacobs y van Lohuizen 1999), y es probable que las proteínas PcG se recluten en los PRE mediante la brecha represiva o las proteínas de regla de pares, u otro intermediario de unión al ADN.

Las proteínas del grupo Drosophila Trithorax (TRX) cumplen una función recíproca con las proteínas PcG y mantienen el estado transcripcional activo de los genes Ant-C y Bx-C (Breen y Harte 1993 Kennison 1993 Gindhart y Kaufman 1995). Trithorax (TRX), el homónimo y el miembro mejor caracterizado del grupo (Ingham y Whittle 1980 Ingham 1985), se acumula en un patrón espacialmente modulado, comenzando con franjas parecidas a reglas de pares en la parte posterior del embrión. Esto puede regular la transcripción temprana de Bx-C (Sedkov et al. 1994), ya que los mutantes trx han alterado la expresión del gen Bx-C durante la extensión de la banda germinal. Sin embargo, la expresión del gen Ant-C permanece inalterada hasta las últimas etapas del desarrollo. Hay alelos de trx que afectan la expresión del gen Ant-C tardío sin efecto sobre la expresión de Bx-C, lo que indica la presencia de múltiples productos, con múltiples funciones, del locus trx. Los mutantes nulos de trx imitan las mutaciones de pérdida de función en los grupos Ant-C y Bx-C, que a veces producen moscas con seis apéndices torácicos dorsales de identidad similar a un ala, el fenotipo por el que se denominan el gen y el grupo (Ingham 1998). Al igual que las proteínas PcG, se sospecha que el grupo TRX puede no unirse directamente al ADN, sino que actúa a través de otras proteínas con actividad de unión al ADN. Curiosamente, el análisis de la localización de las proteínas PcG y TRX en los cromosomas politénicos de las glándulas salivales demuestra que estas proteínas se unen a muchas de las mismas regiones cromosómicas, que incluyen la Ant-C y la Bx-C. Por tanto, la interacción entre estas proteínas reguladoras opuestas en los mismos sitios cromosómicos puede ser importante para su función (Kuzin et al. 1994 Chinwalla et al. 1995). Una nota final importante: aunque estos complejos proteicos funcionan para mantener el estado inicial de actividad del gen C en una región particular, los genes Hom-C no están de ninguna manera "bloqueados" en un estado de actividad particular durante el desarrollo. Esto es evidente en los patrones dinámicos de expresión observados para genes individuales Hom-C durante el curso del desarrollo y discutidos anteriormente en este capítulo.

estructuras reducidas de los ojos y la cabeza. Algunos de los defectos se asemejan a los defectos de la cabeza observados en los alelos hipermórficos de Dfd, y se demostró que los fenotipos mxc observados dependen de la dosis de Dfd. En ausencia de mxc, Dfd se expresa ectópicamente en el ojo / disco antenal. En conjunto, los resultados apoyan a mxc como regulador de la expresión de Dfd, necesaria para limitar la expresión de Dfd en el ojo / disco antenal. Se identificaron dos loci Trx en un cribado de mutaciones que aumentaban la semiletalidad de los alelos Dfd hipomórficos: kismet (kis) y snaggletooth (snt) (Gellon et al. 1997). Ambos son supresores de la función Pc y causan un defecto de la cabeza embrionaria cuando son homocigotos. Curiosamente, kis se identificó originalmente en una pantalla de modificadores de mutaciones de Pc y Antp, lo que revela que este gen funciona para mantener la expresión de múltiples genes Hom-C.

Se encontró que dos regiones específicas de secuencia reguladora, una 15 Kb aguas abajo y una 40 Kb aguas arriba del sitio de inicio de la transcripción Scr, respondían genéticamente a los loci PcG y Trx para efectuar la expresión de Scr durante la embriogénesis posterior y el desarrollo imaginal (Gindhart y Kaufman 1995). Una secuencia de 10 Kb ubicada en la región de 40 Kb fue capaz de reprimir la expresión de un constructo indicador de Scr de una manera dependiente de PcG y Trx. Se requieren dos genes PcG, peines sexuales adicionales (esc) y peines sexuales adicionales (Asc) para el silenciamiento de Scr en el segundo y tercer disco de la pierna torácica (Pattatucci y Kaufman 1991). Se demostró que se requiere un loci Trx, Brahma, para el mantenimiento de la expresión adecuada de Scr en el primer disco imaginal torácico de la pierna (Tamkun et al. 1992). La proteína de cambio dorsal 1 (DSP1) es una proteína HMG de Drosophila que puede actuar como una proteína del grupo PcG o del grupo Trx, dependiendo del locus diana (Decoville et al. 2001). Se demostró que DSP1 está específicamente involucrado en la regulación espacio-temporal de la expresión de Scr en los primeros discos imaginales torácicos (Rappailles et al.2004) Los autores pudieron localizar dos regiones de 1 kilobase en la secuencia reguladora de 10 kilobase, previamente identificada por Gindhart y Kaufman, que interactúan directamente con DSP1. El producto del gen trx tiene un papel en el mantenimiento de la expresión de Dfd y Scr, junto con varios otros genes Hom-C (Breen y Harte 1993). Los mutantes del trithorax (trx) exhiben una expresión reducida, pero no ausente, de Dfd y Scr; la reducción en la expresión es insuficiente para causar efectos fenotípicos significativos, lo que sugiere que otros factores también actúan para mantener Dfd y Scr durante la embriogénesis tardía.

de PS2 durante la mitad de la embriogénesis (Henderson y Andrew 2000). Curiosamente, este es un ciclo de retroalimentación en el que el mantenimiento de la expresión de Scr por parte de hth conduce a la inhibición de la expresión de hth por parte de Scr y, en última instancia, a la pérdida de la expresión de Scr en los primordios de las glándulas salivales.

Regulación postraduccional de Scr

No toda la regulación del gen Hom-C ocurre al nivel de la transcripción La función de la proteína Hom-C también se modula postraduccionalmente. El brazo N-terminal del homeodominio es importante para la especificidad de la función del homeodominio (discutido a continuación), y esta región de la proteína Scr es un objetivo para una subunidad reguladora de la proteína fosfatasa 2A específica de serina-treonina (dPP2A, B ' ) (Berry y Gehring 2000). El estado de fosforilación de dos residuos clave en la porción N-terminal del homeodominio (Thr6 y Ser7) es crítico para la función Scr. Estos residuos pueden fosforilarse mediante la quinasa A dependiente de AMPc (PKA) y desfosforilarse mediante dPP2A en células cultivadas. La expresión ectópica de una construcción de proteína Scr que imita la desfosforilación constitutiva (con Thr6 y Ser7 alterados a alanina), reproduce el fenotipo embrionario inducido por la expresión ectópica de la proteína de tipo salvaje (pérdida de algunas estructuras bucales, formación de glándulas salivales ectópicas y transformación de el segundo y tercer segmento torácico hacia una primera identidad torácica). Por el contrario, una construcción de proteína Scr expresada ectópicamente, en la que los residuos Thr6 y Ser7 se alteran para imitar la fosforilación constitutiva, no puede reproducir el fenotipo Scr ectópico embrionario y tiene una capacidad reducida para unirse a una secuencia de ADN diana in vitro. Además, parece que se requiere dPP2A, B 'para la función Scr endógena, ya que los embriones que carecen de dPP2A, B' no logran formar glándulas salivales.

expresión epidérmica en los compartimentos posteriores de los segmentos torácico y abdominal (Pelaz et al. 1993). Curiosamente, esta expansión depende de niveles moderados de Antp ectópico (normalmente reprimido por las proteínas Bx-C), que activa Scr en el contexto de los segmentos posteriores del tronco en ausencia de las proteínas Bx-C.

En dos estudios recientes, Miller y colaboradores utilizaron el sistema UAS-Gal4 (Brand y Perrimon 1993) para investigar las relaciones de regulación cruzada embrionarias de los genes Hom-C (Miller et al. 2001a Miller et al. 2001b). Los genes Hom-C demuestran actividades de regulación cruzada específicas de tejido. Por ejemplo, Scr ectópico y Dfd ectópico activan pb en el ectodermo, lo que es consistente con el papel normal de estas proteínas en la activación de la expresión de pb en el embrión (Rusch y Kaufman 2000). En el mesodermo, sin embargo, Scr ectópico reprime la expresión de pb (Miller et al. 2001a). La jerarquía de la regulación cruzada en el SNC también difiere de la de la epidermis. Los ectópicos Ubx y Abd-A solo pueden reprimir dos genes Hom-C (Scr, lab) en el SNC, mientras que Ubx y Abd-A tienen mayores efectos de regulación cruzada en la epidermis. Miller y col. concluyen que ningún modelo simple describe de manera exhaustiva las relaciones reguladoras entre los genes Hom-C. Sus interacciones en el SNC y el mesodermo son más complejas y es probable que las cascadas de señalización contribuyan a esta complejidad. La evaluación de la relación entre la regulación autónoma celular y la transducción de señales los llevó a proponer una nueva relación jerárquica en el mesodermo, denominada "dominancia autónoma", en la que la determinación extrínseca del destino celular a través de la señalización puede ser anulada por la expresión de proteínas Hom-C. .

Se han caracterizado varios elementos autorreguladores de Dfd regionalmente específicos que mantienen la expresión de Dfd de una manera específica de tejido (Kuziora y McGinnis 1988 Bergson y McGinnis 1990 Regulski et al. 1991 Zeng et al. 1994).Estos elementos pueden estar ubicados corriente arriba del promotor o dentro de regiones intrónicas. Por ejemplo, un elemento autorregulador específico del SNC de Dfd mapea dentro del intrón Dfd grande (Lou et al. 1995), mientras que un potenciador epidérmico reside corriente arriba del promotor Dfd (Bergson y McGinnis 1990 Zeng et al. 1994).

identidad, como evidencia por la pérdida parcial de las estructuras bucales y la formación de glándulas salivales ectópicas (Zeng et al. 1993). Por tanto, Scr anula el patrón normal dirigido por Dfd en los lóbulos mandibular y maxilar. Esto podría deberse a un nivel más alto de Scr que Dfd en estas regiones. Sin embargo, no hay efecto fenotípico en el tronco posterior al segundo segmento torácico. El Scr ectópico parece incapaz de reemplazar las funciones de las endógenas Ubx, Abd-A y Abd-B, aunque estas proteínas probablemente sean menos abundantes. De manera similar, la expresión ectópica ubicua de Ubx provoca la transformación de segmentos anteriores al primer abdominal, incluyendo el desarrollo de dentículos de tipo abdominal en la cabeza y en el tórax (González-Reyes y Morata 1990), pero aquellos segmentos posteriores al primer abdomen no se alteran. Por lo tanto, al igual que Scr, Ubx no puede anular la función Abd-A y Abd-B en la epidermis. Sin embargo, existen violaciones al modelo de prevalencia posterior. Por ejemplo, la expresión ectópica de Dfd es capaz de inducir ganchos bucales ectópicos en el segmento labial, alterar el patrón de dentículo del segundo segmento torácico para que se parezca al primer segmento torácico y producir cirros sensoriales ectópicos y material esclerotizado en forma de pieza bucal en el tronco. segmentos (Kuziora y McGinnis 1988) aparentemente alterando así los patrones dirigidos por las proteínas Hom-C endógenas en estas células.

LA PROTEÍNA HOM-C HOMEODOMAINA

Por ejemplo, Dfd y un homólogo de mamífero HoxD-4 (Hox-4.2) se conservan dentro del homeodominio en 55 de 60 residuos. La expresión de HoxD-4 en Drosophila es capaz de activar un indicador sensible a Dfd en embriones y produce fenotipos adultos similares a los provocados por una ganancia dominante de función del alelo Dfd (McGinnis et al. 1990).

Además de los genes Hom-C, existen muchos otros genes que codifican el homeodominio de Drosophila. Varios están bien estudiados y proporcionan gran parte de la base para nuestra comprensión de la estructura y función del homeodominio. Ejemplos particularmente bien caracterizados incluyen los genes de segmentación engrailed (en) (Desplan et al. 1985 Desplan et al. 1988 Kissinger et al. 1990 Ohkuma et al. 1990 Jaynes y O'Farrell 1991 Ades y Sauer 1994 Clarke et al. 1994 Bourbon et al. 1995) y fushi tarazu (ftz) (Nelson y Laughon 1990 Percival-Smith et al. 1990 Florence et al. 1991 Walter et al. 1994), y el factor materno bicoide (bcd) (Hanes y Brent 1989 Treisman et al. al.1989 Hanes et al.1994). Todas las proteínas Hom-C y otras proteínas que contienen homeodominio, incluidas Even-skipped (Eve), Ftz y En, tienen un residuo de glutamina (Q) conservado en la posición 50 del homeodominio y se denominan homeoproteínas Q50 (Biggin y McGinnis 1997).

Las conclusiones de estos estudios pueden aplicarse razonablemente a los genes Hom-C restantes y probablemente también a otras proteínas del homeodominio Q50.

Los estudios llevados a cabo para caracterizar la función del homeodominio incluyeron interacciones genéticas, ensayos de transcripción, ensayos de entrecruzamiento de ADN / proteínas, inmunoprecipitación y experimentos de huellas de ADN. Los resultados de este trabajo caracterizaron el homeodominio como motivo de unión al ADN y las proteínas Hom-C como reguladores de la transcripción (Desplan et al. 1985 Müller et al. 1988 Krasnow et al. 1989 Samson et al. 1989 Johnson et al. 1995). De hecho, el homeodominio es uno de los motivos de unión al ADN más comunes que se encuentran en los reguladores transcripcionales eucariotas, solo superado por la clase de dedos de zinc C2H2 (Tupler et al. 2001).

Numerosos estudios de unión de ADN in vitro con los homeodominios de Hom-C dieron como resultado la caracterización de una secuencia de reconocimiento de ADN de consenso central. Un estudio temprano de las interacciones proteína Hom-C / ADN utilizó la secuencia de reconocimiento del homeodominio Antp (Antp-HD), que exhibía una afinidad de unión de ADN específica para la secuencia 5'-TAATG-3 '(Müller et al. 1988 Affolter et al. 1990 Ekker y col. 1991). Otros estudios de interacciones Hom-C / ADN involucran proteínas Dfd, Antp, Ubx y Abd-B de longitud total o parcial (Desplan et al. 1988 Müller et al. 1988 Affolter et al. 1990 Ekker et al. 1991 Ekker et al. 1992 Ekker et al.1994 Wilson et al.1995). Aunque Abd-B parece unirse preferentemente a una secuencia central ligeramente diferente de 5'-TTAT-3 '(Ekker et al. 1994), los homeodominios de la proteína Hom-C reconocen consistentemente una secuencia central consenso de 5'-TAAT-3' dentro de los sitios de reconocimiento caracterizados de 5-9 pares de bases.

Figura 6: Homeodominio de la proteína Hom-C

aunque las proteínas Hom-C reconocen y se unen a secuencias de ADN específicas, parece que pueden superponerse y que todas reconocen la misma secuencia central. La conclusión es que debe haber mecanismos adicionales in vivo involucrados en la dirección de sus especificidades de patrones biológicos.

Especificidad funcional del Homeodominio Hom-C

Debido a la fuerte conservación de aminoácidos y las aparentes similitudes en el reconocimiento del sitio objetivo, varios estudios han intentado diseccionar los homeodomios de la proteína Hom-C para identificar residuos específicos críticos para su función biológica. Varios grupos abordaron este problema construyendo proteínas Hom-C quiméricas (intercambiando varias regiones de una proteína Hom-C por otra) y luego expresando las quimeras en embriones y adultos de Drosophila para analizar los resultados del desarrollo y los efectos sobre la expresión del gen objetivo. Aunque este tipo de estudios han involucrado a la mayoría de las proteínas Hom-C, a continuación resumo los resultados de estudios de intercambio seleccionados que involucran el homeodominio Ubx, insertado en la proteína Dfd (Kuziora y McGinnis 1989 Dessain et al. 1992 Lin y McGinnis 1992) y el homeodominio Scr, insertado en la proteína Antp (Gibson et al. 1990 Furukubo-Tokunaga et al. 1993).

La sustitución del homeodominio Ubx en una proteína Dfd por lo demás normal es suficiente para introducir la regulación de la diana Ubx y anular la actividad Dfd normal. La Dfd de tipo salvaje puede autorregular su propia expresión en algunas células, uniéndose a elementos autorreguladores definidos para mantener su transcripción (Kuziora y McGinnis 1988 Lou et al. 1995). La activación ectópica de Dfd de tipo salvaje da como resultado el desarrollo de material de la pieza bucal ectópica y cirros maxilares en los segmentos del tronco, y la autoactivación de Dfd fuera de su dominio normal. La activación de un constructo Dfd quimérico inducible por choque térmico, que codifica el homeodominio Ubx en lugar del homeodominio Dfd, da como resultado una transformación de los segmentos de la cabeza larvaria hacia una identidad torácica, como también resulta de la expresión ectópica de Ubx (González-Reyes y Morata 1990). ). También se observa la activación ectópica de Antp P1, una diana Ubx conocida (Beachy et al. 1988), y la pérdida concomitante de la autorregulación de Dfd (Kuziora y McGinnis 1989). Por tanto, la quimera Dfd / Ubx, con solo la región del homeodominio cambiada, altera la función de la proteína para parecerse a una construcción de proteína Ubx de tipo salvaje.

una construcción de proteína Dfd por lo demás normal (Lin y McGinnis 1992). Se probó cada construcción para determinar su capacidad para activar el elemento autorregulador Dfd y el promotor Antp P1. Las construcciones que retienen la región del homeodominio N-terminal de Ubx también retienen la transformación de la cabeza larvaria a torácica producida por la construcción Dfd / Ubx original y activan la transcripción ectópica de Antp P1. Además, la sustitución de sólo unos pocos residuos de homeodominio Ubx N-terminales (números 0-9, ver Figura 9) es suficiente para alterar la función ectópica de Dfd y permitir el inicio de la transcripción ectópica de Antp P1. Una quimera que contiene el homeodominio Ubx con la región del homeodominio Dfd N-terminal no activa la transcripción ectópica de Antp P1 y pierde la capacidad de inducir una transformación de la cabeza al tórax. Las regiones de homeodominio N-terminal y C-terminal son necesarias para la autoactivación completa de Dfd; no es posible la autoactivación sin la región N-terminal Dfd y solo es posible una autoactivación débil con la parte C-terminal ausente. En resumen, estos estudios demuestran que el homeodominio es capaz de dirigir la función de la proteína Hom-C y, específicamente, la región del homeodominio N-terminal por sí sola es suficiente para alterar la función de la proteína Hom-C. La región flanqueante C-terminal también contribuye a la especificidad funcional.

Otros adoptaron un enfoque similar al comparar dos proteínas Ant-C, Antp y Scr. Gibson, et al., (1990) utilizaron el grado de transformación y la acumulación de transcripciones de genes diana para evaluar la especificidad funcional de una serie de proteínas quiméricas expresadas ectópicamente. El homeodominio Scr se sustituyó en una construcción de proteína Antp por lo demás normal y la quimera se expresó en embriones y adultos, utilizando un promotor de choque térmico inducible. Este trabajo determinó que la especificidad funcional radica en residuos tanto dentro como adyacentes al homeodominio, y corroboró los resultados obtenidos con los estudios Dfd y Ubx.

la proteína Scr / Antp quimérica (Antp de tipo salvaje con el homeodominio Scr), una proteína Scr funcional se revierte a una proteína Antp funcional. Por lo tanto, la sustitución de estos cuatro aminoácidos por sí sola es suficiente para determinar la diferencia funcional entre Antp y Scr. Estudios similares que involucraron a Ubx y Antp, y Dfd y Abd-B produjeron resultados similares (Kuziora y McGinnis 1990 Chan y Mann 1993 Zhu y Kuziora 1996). Por lo tanto, la especificidad funcional entre los homeodominios de dos proteínas Ant-C diferentes parece estar determinada por solo unos pocos aminoácidos críticos dentro de la porción N-terminal del homeodominio, mientras que los residuos dentro de la gran región N-terminal al homeodominio dirigen solo el extensión de los efectos funcionales de la proteína.

Como se discutió anteriormente, el estado de fosforilación de dos residuos de homeodominio N-terminales (6 y 7) es crítico para la función Scr. En la posición 6 del homeodominio, Scr tiene un residuo de treonina, mientras que Antp tiene un residuo de glutamina no fosforilable. El estado de fosforilación de este residuo de homeodominio N-terminal puede, al menos en parte, explicar algunas de las diferentes especificidades funcionales de los homeodominios Scr y Antp.

diferencias en el reconocimiento de la secuencia de ADN diana, ya que los homeodominios no cambian entre isoformas. Esta aparente incongruencia entre la especificidad de la función de la proteína Hom-C y la aparente falta de especificidad en el reconocimiento de la diana del ADN se denomina con frecuencia la "paradoja HOX". Entonces, parece probable que la especificidad funcional resulte de diferencias espaciales y / o temporales en la expresión y las interacciones proteicas diferenciales. La región N-terminal del homeodominio y las regiones altamente variables fuera de la porción conservada del homeodominio pueden guiar las interacciones de cofactor para dirigir la especificidad del desarrollo provocada por los genes selectores homeóticos.

INTERACCIONES COOPERATIVAS ENTRE PROTEÍNAS HOM-C Y OTROS FACTORES

Esto está muy bien ilustrado por estudios que utilizan la proteína Hom-C Dfd y una secuencia autorreguladora de Dfd conocida. Los múltiplos de un pequeño fragmento de unión a Dfd, derivado de un potenciador de la autoactivación de Dfd, son suficientes para impulsar la expresión del indicador de β-galactosidasa en el segmento maxilar de los embriones de Drosophila. Sin embargo, la pérdida de una secuencia repetida invertida imperfecta elimina la expresión del indicador maxilar (Zeng et al. 1994), lo que sugiere que otras proteínas también deben unirse a este fragmento para permitir la activación de la transcripción. Además, la proteína Dfd se une fuertemente, in vitro, a una repetición en tándem de su sitio de reconocimiento de consenso, pero solo puede activar significativamente la transcripción de una construcción informadora que contiene este sitio cuando está acompañada por el dominio de activación constitutivo de VP16 (Li et al. 1999a ). Por tanto, a pesar de la unión fuerte, Dfd solo es insuficiente para activar el informador sin la adición de una secuencia de activación, lo que indica además la necesidad de factores adicionales. Finalmente, la fusión Dfd-VP16 activa la expresión ectópica de Scr, in vivo, mientras que la proteína Dfd de tipo salvaje no regula Scr. Esto demuestra que las proteínas Hom-C probablemente se unen, in vivo, a sitios que no se encuentran en los promotores o potenciadores de genes diana normales.

coactivadores (Phillips y Luisi 2000). La levadura también proporciona un ejemplo de una interacción homeodominio / dedo de zinc entre las proteínas PHO2 y SWI5 durante la regulación del gen de la endonucleasa HO (Brazas y Stillman 1993 Brazas et al. 1995). Finalmente, existen proteínas que contienen homeodominio, que también contienen motivos de unión de ADN adicionales para guiar su especificidad de unión.

Para que las proteínas Hom-C dirijan la especificación de las identidades de los segmentos, es evidente que se requieren factores o mecanismos adicionales más allá de la simple unión de una proteína Hom-C a un sitio de reconocimiento. ¿Cómo pueden contribuir los cofactores a la selección de genes diana? Mencionamos anteriormente dos modelos propuestos por Biggin y McGinnis (1997) para el papel de los cofactores durante la regulación de la diana de la proteína Hom-C. Aunque hay evidencia para ambos modelos, el modelo de vinculación generalizada parece tener el mayor apoyo. Sin embargo, debemos señalar que no es probable que este sea un proceso simple que involucre uno, dos o incluso tres factores. Lo más probable es que el proceso de selección de genes diana involucre múltiples factores, y quizás algunos, como los productos del gen gap, se expresen antes que las proteínas Hom-C. Además, cuando se piensa en la función del cofactor, se podría esperar una interacción directa con las proteínas Hom-C, pero no es necesario que sea así. Algunas proteínas que funcionan como cofactores pueden ni siquiera ser proteínas de unión al ADN, pero pueden servir como "enlazadores", necesarios para estabilizar las interacciones entre la maquinaria de transcripción basal y las proteínas Hom-C. Claramente, se necesita mucha más investigación, y debido a que existen diferencias entre las diferentes especies de insectos, tal vez un estudio comparativo pueda dar respuestas a algunas de estas preguntas.

Hay varias características genéticas y bioquímicas que podríamos esperar en un cofactor Hom-C:

• La ausencia del cofactor duplicaría fenotipos mutantes de Hom-C completos o parciales.

• Un cofactor actuaría en paralelo a la proteína Hom-C, y no funcionaría ni como un regulador aguas arriba ni como un objetivo aguas abajo (aunque podríamos esperar alguna “conversación cruzada” regulatoria entre los dos).

• La expresión del gen diana Hom-C se reduciría o estaría ausente en las moscas que carecen del cofactor.

Se han descrito varios productos génicos de Drosophila que cumplen muchos o todos estos criterios. La extradentícula del gen que codifica el homeodominio (exd) es el cofactor Hom-C mejor caracterizado (Peifer y Wieschaus 1990). Otros genes propuestos para codificar co-factores de Hom-C incluyen el miembro de la familia bZip cap'n'collar (cnc), dos genes que codifican nuevos reguladores de transcripción putativos, líneas (lin) y apóntico (apt), y el dedo de zinc. genes codificantes teashirt (tsh), desconectado (disco), relacionado con el disco (disco-r) y quizás, buttonhead (btd).

Extradenticle (Exd) es un cofactor de proteína Hom-C

extradenticle codifica una proteína de 378 aminoácidos necesaria para un patrón embrionario y adulto adecuado. exd es homólogo al grupo pbx de genes de vertebrados (Rauskolb et al. 1993) y es un miembro de la clase PbX altamente conservada de proteínas homeodominio (Bürglin 1994). El homeodominio Exd difiere de los de los genes Hom-C, y tiene tres residuos adicionales entre la primera y la segunda hélice alfa. Los homeodomios atípicos de este tipo se denominan homeodominios de extensión de bucle de tres aminoácidos (TALE). Un segundo dominio conservado es el dominio PbC-A, a través del cual Exd interactúa con una proteína que contiene un segundo homeodominio, el homotórax (Hth) (Ryoo et al. 1999). Esta interacción se analiza en detalle a continuación.

Los embriones que carecen de la función cigótica Exd mueren durante la embriogénesis tardía y tienen defectos en la formación general del patrón (Peifer y Wieschaus 1990). Se interrumpe el desarrollo de algunas estructuras de la cabeza y se alteran los segmentos torácicos; el segundo segmento torácico adopta un primer patrón de dentículo similar al torácico y el tercer segmento torácico muestra características tanto del primer segmento torácico como del segundo segmento abdominal. Las identidades de los segmentos abdominales se transforman en aquellos dos o tres segmentos más posteriores. Por ejemplo, el primer segmento abdominal se parece al tercero o cuarto. No se detecta ningún efecto en la mayoría de los segmentos posteriores. Los alelos más débiles son letales post-embrionarios que a menudo forman faratos adultos con defectos de cutícula, y el análisis clonal demuestra que la falta de Exd también causa la transformación de las estructuras adultas (González-Crespo y Morata 1995 Rauskolb et al. 1995). Los clones exd nulos dan como resultado una transformación homeótica de las estructuras de la cabeza, las piernas y los segmentos abdominales de los adultos que se asemejan a los fenotipos observados en algunos mutantes de Hom-C. Antena y arista se transforman en pierna, mientras que la cápsula de la cabeza se altera para parecerse al tórax dorsal o notum. Los clones abdominales del primer al cuarto segmento se transforman en el quinto o seis segmentos abdominales. La sobreexpresión ubicua de exd no tiene ningún efecto sobre las identidades de los segmentos (Rauskolb et al. 1995). Debido a que los mutantes exd parecían tener alteraciones en la especificidad del objetivo de Hom-C, Peifer y Wieschaus propusieron exd como un cofactor de Hom-C.

Para explorar la interacción y la contribución de las proteínas Hom-C y Exd al desarrollo, los embriones mutantes para exd se compararon con embriones mutantes simples para los genes Hom-C y doblemente mutantes para un gen Hom-C y exd. Los mutantes dobles diferían de los mutantes simples, lo que indica que los genes Hom-C continuaron activos dentro de sus dominios normales en ausencia de exd, aunque no pueden especificar correctamente la identidad segmentaria (Peifer y Wieschaus 1990). Por ejemplo, los mutantes exd individuales exhiben una transformación del primer segmento abdominal al tercero, del segundo segmento abdominal al cuarto y del tercer segmento abdominal al quinto. Un mutante abd-A exhibe una transformación de estos mismos segmentos en una identidad A1. El mutante doble exd abd-A transforma todos estos mismos segmentos en una identidad A3. Estos resultados indican además que exd funciona en una ruta paralela a los genes Hom-C y es necesario para la especificación normal de la identidad del segmento por los genes Hom-C examinados.


Ver el vídeo: #44. Andrógenos suprarrenales y anomalías de la secreción cortico suprarrenal (Junio 2022).


Comentarios:

  1. Swift

    Esta idea ha expirado

  2. Rovere

    Genial ... genial ...

  3. Enando

    De acuerdo, mensaje útil

  4. Witter

    ¿Crees que no importa?

  5. Irwin

    Le ofrezco visitar el sitio web, donde hay mucha información sobre el tema de interés para usted.



Escribe un mensaje